National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17183R-4 
 Symbol MED30  Full Name Mediator complex subunit 30 
 CG No CG17183  Old CG No CG17183 
 Synonyms Med30, Trap25, CG17183, Med11/TRAP25, dMED20, dTRAP25, Med20, MED30 
 Accession No (Link to NCBI) NM_138202.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACGGTCAAAACCAGGGTAATC 
 Primer Seq. 3'
aatctagaggtaccCTGCGAGATAGCCAGCATATT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACGGTCAAAA CCAGGGTAAT CAGGGACCAT CGAGCGGCGG CGGAGGAGGC GGGGGCCCCA 
0061 ACATGATGCC GATGGGTGGA TTTGGCATGC AGCACGGCAA TATGCAGCAA ATGCACATGT 
0121 CGCCTCAACA TCAACAGCAG CAACAACAAA TGGGCATGAT GGGCGGCCCG GGTAGCATGC 
0181 AGATGAATCC CCAAGGACCT GGAGGTCCTG GNCGGCCTGA TGCCCGGCAT GTCTCCGCAG 
0241 CACCAGATGC AGCAACAGCA GCAGCAGCAG ATGATGCAGC AGCAAATGAT GGTGCCCCAA 
0301 CAAGGAGTGG GCGTCGGAGT GGGAATGGGC GGTGGTGTGG GAATGGGCGG AGGGGGAGTG 
0361 GTTCCACAGC AGCAGCAACA GCAGCCCCAA CAAAACATGC CCCAGCAGAA CATTCCCCAA 
0421 CAGCAACAGC AACAGCAACT CAATCCGGTC GCAGGAATTC CAcNCGGTGG AgNCGGGGGC 
0481 AGCAACAATA TGCTGGCTAT CTCGCAg 
 in silico PCR Fragment
0001 ACGGTCAAAA CCAGGGTAAT CAGGGACCAT CGAGCGGCGG CGGAGGAGGC GGGGGCCCCA 
0061 ACATGATGCC GATGGGTGGA TTTGGCATGC AGCACGGCAA TATGCAGCAA ATGCACATGT 
0121 CGCCTCAACA TCAACAGCAG CAACAACAAA TGGGCATGAT GGGCGGCCCG GGTAGCATGC 
0181 AGATGAATCC CCAAGGACCT GGAGGTCCTG G-CGGCCTGA TGCCCGGCAT GTCTCCGCAG 
0241 CACCAGATGC AGCAACAGCA GCAGCAGCAG ATGATGCAGC AGCAAATGAT GGTGCCCCAA 
0301 CAAGGAGTGG GCGTCGGAGT GGGAATGGGC GGTGGTGTGG GAATGGGCGG AGGGGGAGTG 
0361 GTTCCACAGC AGCAGCAACA GCAGCCCCAA CAAAACATGC CCCAGCAGAA CATTCCC--- 
0421 ---CAACAGC AACAGCAACT CAATCCGGTC GCAGGAATTC CACCCGGTGG AGCCGGGGGC 
0481 AGCAACAATA TGCTGGCTAT CTCGCAG 
 Assemble Data

17183R-4.IR_full       1   ACGGTCAAAACCAGGGTAATCAGGGACCATCGAGCGGCGGCGGAGGAGGCGGGGGCCCCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17183R-4.in silico     1   ACGGTCAAAACCAGGGTAATCAGGGACCATCGAGCGGCGGCGGAGGAGGCGGGGGCCCCA 60


17183R-4.IR_full       61  ACATGATGCCGATGGGTGGATTTGGCATGCAGCACGGCAATATGCAGCAAATGCACATGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17183R-4.in silico     61  ACATGATGCCGATGGGTGGATTTGGCATGCAGCACGGCAATATGCAGCAAATGCACATGT 120


17183R-4.IR_full       121 CGCCTCAACATCAACAGCAGCAACAACAAATGGGCATGATGGGCGGCCCGGGTAGCATGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17183R-4.in silico     121 CGCCTCAACATCAACAGCAGCAACAACAAATGGGCATGATGGGCGGCCCGGGTAGCATGC 180


17183R-4.IR_full       181 AGATGAATCCCCAAGGACCTGGAGGTCCTGGNCGGCCTGATGCCCGGCATGTCTCCGCAG 240
                           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
17183R-4.in silico     181 AGATGAATCCCCAAGGACCTGGAGGTCCTGG-CGGCCTGATGCCCGGCATGTCTCCGCAG 240


17183R-4.IR_full       241 CACCAGATGCAGCAACAGCAGCAGCAGCAGATGATGCAGCAGCAAATGATGGTGCCCCAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17183R-4.in silico     241 CACCAGATGCAGCAACAGCAGCAGCAGCAGATGATGCAGCAGCAAATGATGGTGCCCCAA 300


17183R-4.IR_full       301 CAAGGAGTGGGCGTCGGAGTGGGAATGGGCGGTGGTGTGGGAATGGGCGGAGGGGGAGTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17183R-4.in silico     301 CAAGGAGTGGGCGTCGGAGTGGGAATGGGCGGTGGTGTGGGAATGGGCGGAGGGGGAGTG 360


17183R-4.IR_full       361 GTTCCACAGCAGCAGCAACAGCAGCCCCAACAAAACATGCCCCAGCAGAACATTCCCCAA 420
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||   
17183R-4.in silico     361 GTTCCACAGCAGCAGCAACAGCAGCCCCAACAAAACATGCCCCAGCAGAACATTCCC--- 420


17183R-4.IR_full       421 CAGCAACAGCAACAGCAACTCAATCCGGTCGCAGGAATTCCACNCGGTGGAGNCGGGGGC 480
                              |||||||||||||||||||||||||||||||||||||||| |||||||| |||||||
17183R-4.in silico     421 ---CAACAGCAACAGCAACTCAATCCGGTCGCAGGAATTCCACCCGGTGGAGCCGGGGGC 480


17183R-4.IR_full       481 AGCAACAATATGCTGGCTATCTCGCAG 507
                           |||||||||||||||||||||||||||
17183R-4.in silico     481 AGCAACAATATGCTGGCTATCTCGCAG 507

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  14  100  NM_138202.2  CG17183-RA (MED30), mRNA 
6.84   33  315  858  2410  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
6.84   33  315  858  2410  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
6.84   33  315  858  2410  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
5.18   25  114  384  1158  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
5.18   25  114  384  1155  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
3.52   17  37  219  558  NM_080364.3  CG5461-RA, transcript variant A (bun), mRNA 
3.52   17  37  197  476  NM_001042894.1  CG5461-RF, transcript variant F (bun), mRNA 
3.31   16  44  276  734  NM_139493.2  CG2083-RA (CG2083), mRNA 
2.9   14  73  243  694  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
2.9   14  73  243  694  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
2.9   14  51  197  488  NM_167000.1  CG32778-RA (CG32778), mRNA 
2.9   14  41  130  326  NM_166446.1  CG9696-RD, transcript variant D (dom), mRNA 
2.9   14  41  130  326  NM_080094.2  CG9696-RA, transcript variant A (dom), mRNA 
2.69   13  26  106  283  NM_169653.2  CG31302-RB, transcript variant B (CG31302), mRNA 
2.69   13  26  106  283  NM_169652.2  CG31302-RA, transcript variant A (CG31302), mRNA 
2.69   13  26  106  283  NM_169654.2  CG31302-RC, transcript variant C (CG31302), mRNA 
2.48   12  78  343  922  NM_079903.2  CG15319-RB (nej), mRNA 
2.48   12  46  197  500  NM_176592.1  CG12071-RB, transcript variant B (CG12071), mRNA 
2.48   12  46  197  500  NM_143575.2  CG12071-RA, transcript variant A (CG12071), mRNA 
2.48   12  42  197  478  NM_079507.2  CG2530-RA (corto), mRNA 
2.28   11  86  269  797  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
2.28   11  53  202  514  NM_134474.4  CG32532-RA (CG32532), mRNA 
2.07   10  66  245  723  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
2.07   10  66  245  723  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
2.07   10  66  245  722  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
2.07   10  40  186  590  NM_080105.2  CG31243-RF, transcript variant F (cpo), mRNA 
2.07   10  34  159  357  NM_206456.1  CG32466-RB, transcript variant B (rn), mRNA 
2.07   10  31  144  359  NM_132004.2  CG4136-RA (CG4136), mRNA 
2.07   10  31  112  230  NM_057511.3  CG3936-RA (N), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.