National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17180R-1 
 Symbol CG17180  Full Name CG17180 
 CG No CG17180  Old CG No CG17180 
 Synonyms CG17180 
 Accession No (Link to NCBI) NM_138193.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Boda A, Lőrincz P, Takáts S, Csizmadia T, Tóth S, Kovács AL, Juhász G.
Drosophila Arl8 is a general positive regulator of lysosomal fusion events.
Biochim Biophys Acta Mol Cell Res (2019) 1866(4) 533-544 [ PubMed ID = 30590083 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCCACCAGGACATTCCCATC 
 Primer Seq. 3'
aatctagaggtaccTGGGCCACAAAGTGGCGCATC 
 Predicted Fragment Size
443 
 IR fragment full Seq
0001 CGCCACCAGG ACATTCCCAT CCGCCCACGT TACGGTTATG TGGCCGAGGA GAGTGGCCCA 
0061 TCGGAAGGGG CAGCCAGGAG TTCTGGATCC GGAGCCACGC CCGCCTCCTC CTACACGGAA 
0121 ATTCCGTTCC TGGCTCAGTA TCCGGGAGGC GGTGCCAGAG CACGTGCTCC AGGATCTGAC 
0181 GCNCACAGCG CACTGGCCAT GCTGCGATTC CCGGGAGCAC AAAGACAAGA CCCAACGGCG 
0241 AGAAANTACC TTAACCTGGA TTCGGGCGAG GATCCCGACG AGGAAGACGA TCCCTTGGAG 
0301 GAGGAGGACA ACAGCAACTC GAATAGCAAC TCCAAGGGCA GTTCCGGCGA CATCGAAAGG 
0361 CACAGACTGA AGGCAGAGAG CACTGTGCCC TACGAGCTGG ACGGCGAAAC CAGTGACTCC 
0421 GACGGGANTG cgcCACTTTG TGGCCCA 
 in silico PCR Fragment
0001 CGCCACCAGG ACATTCCCAT CCGCCCACGT TACGGTTATG TGGCCGAGGA GAGTGGCCCA 
0061 TCGGAAGGGG CAGCCAGGAG TTCTGGATCC GGAGCCACGC CCGCCTCCTC CTACACGGAA 
0121 ATTCCGTTCC TGGCTCAGTA TCCGGGA-GC GGTGCCAGAG CACGTGCTCC AGGATCTGAC 
0181 GCCCACAGC- CACTGGCCAT GCTGCGATTC CCGGAAGCAC AAAGACAAGA CCCAACGGCG 
0241 AGAAA-TACC TTAACCTGGA TTCGGGCGAG GATCCCGACG AGGAAGACGA TCCCTTGGAG 
0301 GAGGAGGACA ACAGCAACTC GAATAGCAAC TCTAAGGGCA GTTCCGGCGA CATCGAAAGG 
0361 CACAGACTGA AGGCAGAGAG CACTGTGCCC TACGAGCTGG ACGGCGAAAC CAGTGACTCC 
0421 GACGGGA-TG CGCCACTTTG TGGCCCA 
 Assemble Data

17180R-1.IR_full       1   CGCCACCAGGACATTCCCATCCGCCCACGTTACGGTTATGTGGCCGAGGAGAGTGGCCCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17180R-1.in silico     1   CGCCACCAGGACATTCCCATCCGCCCACGTTACGGTTATGTGGCCGAGGAGAGTGGCCCA 60


17180R-1.IR_full       61  TCGGAAGGGGCAGCCAGGAGTTCTGGATCCGGAGCCACGCCCGCCTCCTCCTACACGGAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17180R-1.in silico     61  TCGGAAGGGGCAGCCAGGAGTTCTGGATCCGGAGCCACGCCCGCCTCCTCCTACACGGAA 120


17180R-1.IR_full       121 ATTCCGTTCCTGGCTCAGTATCCGGGAGGCGGTGCCAGAGCACGTGCTCCAGGATCTGAC 180
                           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
17180R-1.in silico     121 ATTCCGTTCCTGGCTCAGTATCCGGGA-GCGGTGCCAGAGCACGTGCTCCAGGATCTGAC 180


17180R-1.IR_full       181 GCNCACAGCGCACTGGCCATGCTGCGATTCCCGGGAGCACAAAGACAAGACCCAACGGCG 240
                           || |||||| |||||||||||||||||||||||| |||||||||||||||||||||||||
17180R-1.in silico     181 GCCCACAGC-CACTGGCCATGCTGCGATTCCCGGAAGCACAAAGACAAGACCCAACGGCG 240


17180R-1.IR_full       241 AGAAANTACCTTAACCTGGATTCGGGCGAGGATCCCGACGAGGAAGACGATCCCTTGGAG 300
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
17180R-1.in silico     241 AGAAA-TACCTTAACCTGGATTCGGGCGAGGATCCCGACGAGGAAGACGATCCCTTGGAG 300


17180R-1.IR_full       301 GAGGAGGACAACAGCAACTCGAATAGCAACTCCAAGGGCAGTTCCGGCGACATCGAAAGG 360
                           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
17180R-1.in silico     301 GAGGAGGACAACAGCAACTCGAATAGCAACTCTAAGGGCAGTTCCGGCGACATCGAAAGG 360


17180R-1.IR_full       361 CACAGACTGAAGGCAGAGAGCACTGTGCCCTACGAGCTGGACGGCGAAACCAGTGACTCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17180R-1.in silico     361 CACAGACTGAAGGCAGAGAGCACTGTGCCCTACGAGCTGGACGGCGAAACCAGTGACTCC 420


17180R-1.IR_full       421 GACGGGANTGCGCCACTTTGTGGCCCA 447
                           ||||||| |||||||||||||||||||
17180R-1.in silico     421 GACGGGA-TGCGCCACTTTGTGGCCCA 447

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   425  NM_138193.1  CG17180-RA (CG17180), mRNA 
0.47   NM_167441.2  CG9176-RB, transcript variant B (cngl), mRNA 
0   NM_130523.2  CG11638-RA (CG11638), mRNA 
0   NM_079268.2  CG10923-RA (Klp67A), mRNA 
0   NM_133057.2  CG6023-RA, transcript variant A (CG6023), mRNA 
0   NM_206780.1  CG6023-RB, transcript variant B (CG6023), mRNA 
0   NM_001042799.1  CG10966-RB, transcript variant B (rdgA), mRNA 
0   NM_078537.2  CG10966-RA, transcript variant A (rdgA), mRNA 
0   NM_143368.1  CG9988-RA (CG9988), mRNA 
0   NM_143271.1  CG14257-RA (CG14257), mRNA 
0   NM_142001.1  CG17319-RA (CG17319), mRNA 
0   20  NM_141384.2  CG15188-RA (Osi20), mRNA 
0   NM_134711.1  CG15824-RA (CG15824), mRNA 
0   NM_143348.2  CG4849-RA (CG4849), mRNA 
0   NM_168877.1  CG3263-RD, transcript variant D (Pka-R1), mRNA 
0   NM_079465.3  CG3263-RB, transcript variant B (Pka-R1), mRNA 
0   NM_001014597.1  CG3263-RF, transcript variant F (Pka-R1), mRNA 
0   NM_001014598.1  CG3263-RE, transcript variant E (Pka-R1), mRNA 
0   NM_001014594.1  CG3263-RI, transcript variant I (Pka-R1), mRNA 
0   NM_001014593.1  CG3263-RJ, transcript variant J (Pka-R1), mRNA 
0   NM_168875.2  CG3263-RA, transcript variant A (Pka-R1), mRNA 
0   NM_001014595.1  CG3263-RH, transcript variant H (Pka-R1), mRNA 
0   NM_001014596.1  CG3263-RG, transcript variant G (Pka-R1), mRNA 
0   NM_168876.4  CG3263-RC, transcript variant C (Pka-R1), mRNA 
0   NM_139557.1  CG12014-RA (CG12014), mRNA 
0   NM_132395.1  CG2898-RA (CG2898), mRNA 
0   NM_140681.3  CG9665-RA (CG9665), mRNA 
0   NM_145873.2  CG18659-RA, transcript variant A (CG18659), mRNA 
0   NM_136614.4  CG18659-RB, transcript variant B (CG18659), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
++ 
DC
++ 
DM
VM
 
VB
 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
++ 
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.