National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17173R-3 
 Symbol CG17173  Full Name CG17173 
 CG No CG17173  Old CG No CG17173 
 Synonyms CG17173 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pharate adult 
 Map Viewer
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||| silico     1   ATGAAGGTGATCAGCATTCGCTGGAAGACCTGCCTGCCAGGCCTTATAATAGTTTCTTAC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CTGGTGTGTGCTCTGTTGTATTTCGGAATGGATATAACAAAGATTGAGCCAGTGGAACCA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AGAGTAGTGAAAAACAAGACCAAAGTGCCACGAATGTATGCCAAAACCATCAATCATGAT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGCAACTGGGAGACTATTGTAACTAATCCGGAATTAAAGCCCAGATATCGGGTTGGCGGC 240

                           || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGCAGGACTGGTGTCCAGTTCGTGATTGGAGTACCCACTGTACTGCGACCGAAAAAGAAC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TATGTGCTCCAAACCGTGGACTGTCTGATCCGTCGAATGACTCCGGAGCAGCGCGACAAT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGTCTAATTGTTATATTCGTGGGTGAAACTAAGCTGCAGTTCGCCAAGTTCATAGTAAGG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAACTGCGTGTGAATCATTCGACGCATATGCAAGCTGGCCTAATCGATGTCATTGCGCCA 480

17173R-3.IR full       481 CCCTTGAATTACTATCCCAA 500
                           |||||||||||||||||||| silico     481 CCCTTGAATTACTATCCCAA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_140464.1  CG17173-RA (CG17173), mRNA 
NM_001038985.1  CG14062-RB (CG14062), mRNA 
NM_168366.2  CG32046-RB, transcript variant B (CG32046), mRNA 
NM_168367.1  CG32046-RA, transcript variant A (CG32046), mRNA 
NM_132713.1  CG11584-RB (CG11584), mRNA 
NM_170306.1  CG31077-RA (CG31077), mRNA 
NM_132759.1  CG9503-RA (CG9503), mRNA 
NM_167846.1  Glucose transporter 1 CG1086-RA, transcript variant A (Glut1), mRNA 
NM_080001.2  pineapple eye CG5354-RA (pie), mRNA 
NM_137768.1  CG13492-RA, transcript variant A (CG13492), mRNA 
NM_166487.2  CG13492-RB, transcript variant B (CG13492), mRNA 
NM_142263.2  CG5013-RA (CG5013), mRNA 
NM_079184.3  Gustatory receptor 63a CG14979-RA (Gr63a), mRNA 
NM_170178.1  CG31381-RA (CG31381), mRNA 
NR_002104.1  roX2, miscRNA 
NM_079435.2  Shaker cognate l CG9262-RA (Shal), mRNA 
NM_058125.3  Rpt1 CG1341-RA (Rpt1), mRNA 
NM_166019.1  short stop CG18076-RH, transcript variant H (shot), mRNA 
NM_176182.1  Inhibitor of apoptosis 2 CG8293-RB, transcript variant B (Iap2), mRNA 
NM_057779.3  Inhibitor of apoptosis 2 CG8293-RA, transcript variant A (Iap2), mRNA 
NM_137621.2  CG10444-RA (CG10444), mRNA 
NM_136069.2  CG10600-RA (CG10600), mRNA 
NM_132438.1  CG11203-RA (CG11203), mRNA 
NM_143520.1  CG15530-RA, transcript variant A (CG15530), mRNA 
NM_170475.1  CG15530-RB, transcript variant B (CG15530), mRNA 
NM_079408.4  Tetraspanin 74F CG5492-RB, transcript variant B (Tsp74F), mRNA 
NM_143465.1  CG1973-RA (CG1973), mRNA 
NM_168754.1  Tetraspanin 74F CG5492-RA, transcript variant A (Tsp74F), mRNA 
NM_166704.1  zipper CG15792-RB, transcript variant B (zip), mRNA 
NM_001014553.1  zipper CG15792-RC, transcript variant C (zip), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.