National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1715R-1 
 Symbol l(3)03670  Full Name lethal (3) 03670 
 CG No CG1715  Old CG No CG1715 
 Synonyms pMY8, l(3)96601, anon-l, l(3)3670, l(3)S127408, x94917, 1274/08, 0966/01, 0812/02, 0353/13, 0205/14, CG1715, l(3)03670 
 Accession No (Link to NCBI) NM_143581.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Deng Q, Guo T, Zhou X, Xi Y, Yang X, Ge W.
Crosstalk Between Mitochondrial Fusion and the Hippo Pathway in Controlling Cell Proliferation During Drosophila Development.
Genetics (2016) [ PubMed ID = 27317679 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATGTGGTCAAGCGACTGAAG 
 Primer Seq. 3'
aatctagaggtaccTCGATGCACTGTCGGAATTGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GATGTGGTCA AGCGACTGAA GGCGGGAATA TCCCAGCAGG CTCGTGAGCA CGCAGCCGCT 
0061 GCGGAGGAAT CGAAACCAGT GCCCAAGCCA ACGACGAAGG CTGCCGCCAA GCCAGCCGCA 
0121 TCCTCGCCAG CTGCTTCTCC TGCTCCGAAA GTATCCTCCT ATCCCGCTGC AGTGCCCATT 
0181 TACGTCCAGG GAGGAGGACA CACCATTAGC GCGGCCGATG TGCAGCGCCA GATGAACCAG 
0241 GAGCTAATCA AGAATGACGA GCTGTGGAAG GAGCGCATGG CGAAGCTGGA GGAGAACCTC 
0301 AAGAAGACCA ACACCATCCT GGAGAAGGAG TACGCCAATG CTGTAGAAAA TGTGCACAAG 
0361 CGATTCGTCA GCACCGCGTC GTCGCACAAA GTGCCTCCCT GCCAGGACCT GAAATCCCAG 
0421 CTGCTTGCCT GCTAGCCGCG CGCATCCCGG GGAGACCTTG AAGTGCATGG AGGAGGTGGC 
0481 CCAATTCCGA CAGTGCATCG A 
 in silico PCR Fragment
0001 GATGTGGTCA AGCGACTGAA GGCGGGAATA TCCCAGCAGG CTCGTGAGCA CGCAGCCGCT 
0061 GCGGAGGAAT CGAAACCAGT GCCCAAGCCA ACGACGAAGG CTGCCGCCAA GCCAGCCGCA 
0121 TCCTCGCCAG CTGCTTCTCC TGCTCCGAAA GTATCCTCCT ATCCCGCTGC AGTGCCCATT 
0181 TACGTCCAGG GAGGAGGACA CACCATTAGC GCGGCCGATG TGCAGCGCCA GATGAACCAG 
0241 GAGCTAATCA AGAATGACGA GCTGTGGAAG GAGCGCATGG CGAAGCTGGA GGAGAACCTC 
0301 AAGAAGACCA ACACCATCCT GGAGAAGGAG TACGCCAATG CTGTAGAAAA TGTGCACAAG 
0361 CGATTCGTCA GCACCGCGTC GTCGCACAAA GTGCCTCCCT GCCAGGACCT GAAATCCCAG 
0421 CTGCTTGCCT GCTA-CCGCG CGCATCCCGG GGAGACCTTG AAGTGCATTG AGGAGGTGGC 
0481 CCAATTCCGA CAGTGCATCG A 
 Assemble Data

1715R-1.IR_full       1   GATGTGGTCAAGCGACTGAAGGCGGGAATATCCCAGCAGGCTCGTGAGCACGCAGCCGCT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1715R-1.in silico     1   GATGTGGTCAAGCGACTGAAGGCGGGAATATCCCAGCAGGCTCGTGAGCACGCAGCCGCT 60


1715R-1.IR_full       61  GCGGAGGAATCGAAACCAGTGCCCAAGCCAACGACGAAGGCTGCCGCCAAGCCAGCCGCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1715R-1.in silico     61  GCGGAGGAATCGAAACCAGTGCCCAAGCCAACGACGAAGGCTGCCGCCAAGCCAGCCGCA 120


1715R-1.IR_full       121 TCCTCGCCAGCTGCTTCTCCTGCTCCGAAAGTATCCTCCTATCCCGCTGCAGTGCCCATT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1715R-1.in silico     121 TCCTCGCCAGCTGCTTCTCCTGCTCCGAAAGTATCCTCCTATCCCGCTGCAGTGCCCATT 180


1715R-1.IR_full       181 TACGTCCAGGGAGGAGGACACACCATTAGCGCGGCCGATGTGCAGCGCCAGATGAACCAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1715R-1.in silico     181 TACGTCCAGGGAGGAGGACACACCATTAGCGCGGCCGATGTGCAGCGCCAGATGAACCAG 240


1715R-1.IR_full       241 GAGCTAATCAAGAATGACGAGCTGTGGAAGGAGCGCATGGCGAAGCTGGAGGAGAACCTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1715R-1.in silico     241 GAGCTAATCAAGAATGACGAGCTGTGGAAGGAGCGCATGGCGAAGCTGGAGGAGAACCTC 300


1715R-1.IR_full       301 AAGAAGACCAACACCATCCTGGAGAAGGAGTACGCCAATGCTGTAGAAAATGTGCACAAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1715R-1.in silico     301 AAGAAGACCAACACCATCCTGGAGAAGGAGTACGCCAATGCTGTAGAAAATGTGCACAAG 360


1715R-1.IR_full       361 CGATTCGTCAGCACCGCGTCGTCGCACAAAGTGCCTCCCTGCCAGGACCTGAAATCCCAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1715R-1.in silico     361 CGATTCGTCAGCACCGCGTCGTCGCACAAAGTGCCTCCCTGCCAGGACCTGAAATCCCAG 420


1715R-1.IR_full       421 CTGCTTGCCTGCTAGCCGCGCGCATCCCGGGGAGACCTTGAAGTGCATGGAGGAGGTGGC 480
                          |||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||
1715R-1.in silico     421 CTGCTTGCCTGCTA-CCGCGCGCATCCCGGGGAGACCTTGAAGTGCATTGAGGAGGTGGC 480


1715R-1.IR_full       481 CCAATTCCGACAGTGCATCGA 501
                          |||||||||||||||||||||
1715R-1.in silico     481 CCAATTCCGACAGTGCATCGA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.