National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17156R-1 
 Symbol chinmo  Full Name Chronologically inappropriate morphogenesis 
 CG No CG31666  Old CG No CG17156 
 Synonyms Chinmo, chinmo, CG31666, F, unnamed, l(2)04111, CG10871, CG17156, CG17649 
 Accession No (Link to NCBI) NM_134766.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Dillard C, Narbonne-Reveau K, Foppolo S, Lanet E, Maurange C.
Two distinct mechanisms silence chinmo in Drosophila neuroblasts and neuroepithelial cells to limit their self-renewal.
Development (2018) 145(2) [ PubMed ID = 29361557 ] [ RRC reference ]

Narbonne-Reveau K, Lanet E, Dillard C, Foppolo S, Chen CH, Parrinello H, Rialle S, Sokol NS, Maurange C.
Neural stem cell-encoded temporal patterning delineates an early window of malignant susceptibility in Drosophila.
Elife (2016) 5 [ PubMed ID = 27296804 ] [ RRC reference ]

Doggett K, Turkel N, Willoughby LF, Ellul J, Murray MJ, Richardson HE, Brumby AM.
BTB-Zinc Finger Oncogenes Are Required for Ras and Notch-Driven Tumorigenesis in Drosophila.
PLoS ONE (2015) 10(7) e0132987 [ PubMed ID = 26207831 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Strutt H, Searle E, Thomas-Macarthur V, Brookfield R, Strutt D.
A Cul-3-BTB ubiquitylation pathway regulates junctional levels and asymmetry of core planar polarity proteins.
Development (2013) 140(8) 1693-702 [ PubMed ID = 23487316 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCAGCAGCAGTTCTGCCTCA 
 Primer Seq. 3'
aatctagaggtaccTCCTCCCAGACCGATTCCGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGCaGCANGC AGTTCTGCCT CAAATGGAAC AGTTTCTCGT CTAACTTGGC AATAACATTC 
0061 TCCAATCTGT TCAAATCGGA TCTACTGGCC GATGTCATAT TATCCTGCGA TGGCGTAGTA 
0121 TTCAAAGCCC ACAAACTTAT ATTGGCGGCC TGCTCAAAGA AGTTCGCCGA TCTGTTTGAG 
0181 AACACGCCCA CAAATGGCCA GTGCGTCATC ATACTGGAGG CGACCACGCC GGACAACATG 
0241 GCCGCTCTGC TGGAGTTCAT GTACAAAGGC GAGGTCCACG TCTCCCAGGA GGCGCTCAAC 
0301 AGTTTCCTCA AGTCCGCCGA GAGTTTGCAG GTCAAAGGTC TGTCCACGGA AACGGGACGT 
0361 CTGGCGGCAC AGCAGGCACA ACAACACATG GGCGACCTGT CGCCACNTTG ACTCGCCGAC 
0421 GGGCAGGCGG AGCGTAAGGA ACAGCCTGAG CGGCGGTagc AGCANGCATC GTTCCCGGCG 
0481 GAGTCGGAAT CGGTCTGGGA GGA 
 in silico PCR Fragment
0001 CGCAGCA-GC AGTTCTGCCT CAAATGGAAC AGTTTCTCGT CTAACTTGGC AATAACATTC 
0061 TCCAATCTGT TCAAATCGGA TCTACTGGCC GATGTCATAT TATCCTGCGA TGGCGTAGTA 
0121 TTCAAAGCCC ACAAACTTAT ATTGGCGGCC TGCTCAAAGA AGTTCGCCGA TCTGTTTGAG 
0181 AACACGCCCA CAAATGGCCA GTGCGTCATC ATACTGGAGG CGACCACGCC GGACAACATG 
0241 GCCGCTCTGC TGGAGTTCAT GTACAAAGGC GAGGTCCACG TCTCCCAGGA GGCGCTCAAC 
0301 AGTTTCCTCA AGTCCGCCGA GAGTTTGCAG GTCAAAGGTC TGTCCACGGA AACGGGACGT 
0361 CTGGCGGCAC AGCAGGCACA ACAACACATG GGCGACCTGT CGCCAC-TTG ACTCGCCGAC 
0421 GGGCAGGCGG AGCGTAAGGA ACAGCCTGAG CGGCGGTAGC AGCA-GCATC GTTCCCGGCG 
0481 GAGTCGGAAT CGGTCTGGGA GGA 
 Assemble Data

17156R-1.IR_full       1   CGCAGCANGCAGTTCTGCCTCAAATGGAACAGTTTCTCGTCTAACTTGGCAATAACATTC 60
                           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
17156R-1.in silico     1   CGCAGCA-GCAGTTCTGCCTCAAATGGAACAGTTTCTCGTCTAACTTGGCAATAACATTC 60


17156R-1.IR_full       61  TCCAATCTGTTCAAATCGGATCTACTGGCCGATGTCATATTATCCTGCGATGGCGTAGTA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17156R-1.in silico     61  TCCAATCTGTTCAAATCGGATCTACTGGCCGATGTCATATTATCCTGCGATGGCGTAGTA 120


17156R-1.IR_full       121 TTCAAAGCCCACAAACTTATATTGGCGGCCTGCTCAAAGAAGTTCGCCGATCTGTTTGAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17156R-1.in silico     121 TTCAAAGCCCACAAACTTATATTGGCGGCCTGCTCAAAGAAGTTCGCCGATCTGTTTGAG 180


17156R-1.IR_full       181 AACACGCCCACAAATGGCCAGTGCGTCATCATACTGGAGGCGACCACGCCGGACAACATG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17156R-1.in silico     181 AACACGCCCACAAATGGCCAGTGCGTCATCATACTGGAGGCGACCACGCCGGACAACATG 240


17156R-1.IR_full       241 GCCGCTCTGCTGGAGTTCATGTACAAAGGCGAGGTCCACGTCTCCCAGGAGGCGCTCAAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17156R-1.in silico     241 GCCGCTCTGCTGGAGTTCATGTACAAAGGCGAGGTCCACGTCTCCCAGGAGGCGCTCAAC 300


17156R-1.IR_full       301 AGTTTCCTCAAGTCCGCCGAGAGTTTGCAGGTCAAAGGTCTGTCCACGGAAACGGGACGT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17156R-1.in silico     301 AGTTTCCTCAAGTCCGCCGAGAGTTTGCAGGTCAAAGGTCTGTCCACGGAAACGGGACGT 360


17156R-1.IR_full       361 CTGGCGGCACAGCAGGCACAACAACACATGGGCGACCTGTCGCCACNTTGACTCGCCGAC 420
                           |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||
17156R-1.in silico     361 CTGGCGGCACAGCAGGCACAACAACACATGGGCGACCTGTCGCCAC-TTGACTCGCCGAC 420


17156R-1.IR_full       421 GGGCAGGCGGAGCGTAAGGAACAGCCTGAGCGGCGGTAGCAGCANGCATCGTTCCCGGCG 480
                           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
17156R-1.in silico     421 GGGCAGGCGGAGCGTAAGGAACAGCCTGAGCGGCGGTAGCAGCA-GCATCGTTCCCGGCG 480


17156R-1.IR_full       481 GAGTCGGAATCGGTCTGGGAGGA 503
                           |||||||||||||||||||||||
17156R-1.in silico     481 GAGTCGGAATCGGTCTGGGAGGA 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164430.2  CG31666-RD, transcript variant D (CG31666), mRNA 
100   482  NM_134766.3  CG31666-RA, transcript variant A (CG31666), mRNA 
100   482  NM_164429.1  CG31666-RC, transcript variant C (CG31666), mRNA 
100   482  NM_164428.2  CG31666-RB, transcript variant B (CG31666), mRNA 
0.2   NM_139951.1  CG7072-RA (CG7072), mRNA 
0   12  27  NM_169819.1  CG14307-RE, transcript variant E (fru), mRNA 
0   12  27  NM_169820.1  CG14307-RC, transcript variant C (fru), mRNA 
0   12  27  NM_169817.1  CG14307-RG, transcript variant G (fru), mRNA 
0   12  27  NM_169818.1  CG14307-RH, transcript variant H (fru), mRNA 
0   12  26  NM_169822.1  CG14307-RD, transcript variant D (fru), mRNA 
0   12  25  NM_206514.1  CG14307-RK, transcript variant K (fru), mRNA 
0   12  25  NM_206516.1  CG14307-RI, transcript variant I (fru), mRNA 
0   12  25  NM_206515.1  CG14307-RJ, transcript variant J (fru), mRNA 
0   12  25  NM_206513.1  CG14307-RL, transcript variant L (fru), mRNA 
0   12  25  NM_206512.1  CG14307-RM, transcript variant M (fru), mRNA 
0   12  24  NM_079673.2  CG14307-RF, transcript variant F (fru), mRNA 
0   12  24  NM_169816.1  CG14307-RB, transcript variant B (fru), mRNA 
0   12  22  NM_169821.1  CG14307-RA, transcript variant A (fru), mRNA 
0   18  NM_079155.2  CG9102-RA (bab2), mRNA 
0   12  NM_132051.1  CG3726-RA (CG3726), mRNA 
0   NM_132103.2  CG3973-RA (CG3973), mRNA 
0   NM_168837.1  CG17233-RC, transcript variant C (CG17233), mRNA 
0   NM_168836.1  CG17233-RA, transcript variant A (CG17233), mRNA 
0   NM_206175.2  CG8201-RF, transcript variant F (par-1), mRNA 
0   NM_206176.2  CG8201-RD, transcript variant D (par-1), mRNA 
0   NM_206174.2  CG8201-RE, transcript variant E (par-1), mRNA 
0   NM_206172.1  CG8201-RG, transcript variant G (par-1), mRNA 
0   NM_206173.2  CG8201-RC, transcript variant C (par-1), mRNA 
0   NM_001014541.1  CG8201-RM, transcript variant M (par-1), mRNA 
0   NM_167387.1  CG32611-RB (CG32611), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.