National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 17117R-2 
 Symbol hth  Full Name homothorax 
 CG No CG17117  Old CG No CG17117 
 Synonyms Hth, Dm-HTH, P53, CG17117, dtl, hth2, hth1, 1422/04, 1323/07, unnamed, anon-EST:Liang-2.13, clone 2.13, l(3)86Ca, l(3)05745, Meis1, hth 
 Accession No (Link to NCBI) NM_057230.4 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Agrawal P, Habib F, Yelagandula R, Shashidhara LS.
Genome-level identification of targets of Hox protein Ultrabithorax in Drosophila: novel mechanisms for target selection.
Sci Rep (2011) 1 205 [ PubMed ID = 22355720 ] [ RRC reference ]

Sato M, Kitada Y, Tabata T.
Larval cells become imaginal cells under the control of homothorax prior to metamorphosis in the Drosophila tracheal system.
Dev. Biol. (2008) 318(2) 247-57 [ PubMed ID = 18455715 ] [ RRC reference ]

Ghosh N, Bakshi A, Khandelwal R, Rajan SG, Joshi R.
Hox gene Abdominal-B uses DoublesexF as a cofactor to promote neuroblast apoptosis in Drosophila central nervous system.
Development (2019) [ PubMed ID = 31371379 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGGGGTCATGGAACACCTAGT 
 Primer Seq. 3'
aatctagaggtaccTGCGATGTGGAGTCGGCGTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGGGGTCATG GAACACCTAG TCATGTATCG CCGGTCGGTA ATCACCTAAT GGGCGCAATA 
0061 CCCGAAGTAC ACAAACGTGA TAAGGATGCG ATTTATGAAC ATCCGCTATT CCCGCTTTTG 
0121 GCGCTGATCT TTGAGAAGTG CGAATTGGCC ACATGTACGC CGAGGGAGCC CGGTGTGCAA 
0181 GGTGGCGATG TCTGTTCGTC GGAATCGTTC AACGAGGATA TTGCAATGTT CAGTAAACAG 
0241 ATAAGATCAC AGAAACCCTA TTATACCGCA GATCCCGAAG TCGACTCACT GATGGTGCAA 
0301 GCAATACAAG TACTTCGGTT TCACCTTTTA GAATTAGAAA AAGTACACGA GTTATGCGAT 
0361 AACTTCTGTC ATCGGTATAT ATCGTGTTTA AAGGGTAAAA TGCCAATAGA TTTAGTGATC 
0421 GACGAACGGG ACACCACCAA ACCACCGGAG TTGGGATCGG CGAACGGAGA AGGGCGCAgN 
0481 AACGCCGACT CCACATCGCA  
 in silico PCR Fragment
0001 GGGGGTCATG GAACACCTAG TCATGTATCG CCGGTCGGTA ATCACCTAAT GGGCGCAATA 
0061 CCCGAAGTAC ACAAACGTGA TAAGGATGCG ATTTATGAAC ATCCGCTATT CCCGCTTTTG 
0121 GCGCTGATCT TTGAGAAGTG CGAATTGGCC ACATGTACGC CGAGGGAGCC CGGTGTGCAA 
0181 GGTGGCGATG TCTGTTCGTC GGAATCGTTC AACGAGGATA TTGCAATGTT CAGTAAACAG 
0241 ATAAGATCAC AGAAACCCTA TTATACCGCA GATCCCGAAG TCGACTCACT GATGGTGCAA 
0301 GCAATACAAG TACTTCGGTT TCACCTTTTA GAATTAGAAA AAGTACACGA GTTATGCGAT 
0361 AACTTCTGTC ATCGGTATAT ATCGTGTTTA AAGGGTAAAA TGCCAATAGA TTTAGTGATC 
0421 GACGAACGGG ACACCACCAA ACCACCGGAG TTGGGATCGG CGAACGGAGA AGGGCGCAGC 
0481 AACGCCGACT CCACATCGCA  
 Assemble Data

17117R-2.IR_full       1   GGGGGTCATGGAACACCTAGTCATGTATCGCCGGTCGGTAATCACCTAATGGGCGCAATA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17117R-2.in silico     1   GGGGGTCATGGAACACCTAGTCATGTATCGCCGGTCGGTAATCACCTAATGGGCGCAATA 60


17117R-2.IR_full       61  CCCGAAGTACACAAACGTGATAAGGATGCGATTTATGAACATCCGCTATTCCCGCTTTTG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17117R-2.in silico     61  CCCGAAGTACACAAACGTGATAAGGATGCGATTTATGAACATCCGCTATTCCCGCTTTTG 120


17117R-2.IR_full       121 GCGCTGATCTTTGAGAAGTGCGAATTGGCCACATGTACGCCGAGGGAGCCCGGTGTGCAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17117R-2.in silico     121 GCGCTGATCTTTGAGAAGTGCGAATTGGCCACATGTACGCCGAGGGAGCCCGGTGTGCAA 180


17117R-2.IR_full       181 GGTGGCGATGTCTGTTCGTCGGAATCGTTCAACGAGGATATTGCAATGTTCAGTAAACAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17117R-2.in silico     181 GGTGGCGATGTCTGTTCGTCGGAATCGTTCAACGAGGATATTGCAATGTTCAGTAAACAG 240


17117R-2.IR_full       241 ATAAGATCACAGAAACCCTATTATACCGCAGATCCCGAAGTCGACTCACTGATGGTGCAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17117R-2.in silico     241 ATAAGATCACAGAAACCCTATTATACCGCAGATCCCGAAGTCGACTCACTGATGGTGCAA 300


17117R-2.IR_full       301 GCAATACAAGTACTTCGGTTTCACCTTTTAGAATTAGAAAAAGTACACGAGTTATGCGAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17117R-2.in silico     301 GCAATACAAGTACTTCGGTTTCACCTTTTAGAATTAGAAAAAGTACACGAGTTATGCGAT 360


17117R-2.IR_full       361 AACTTCTGTCATCGGTATATATCGTGTTTAAAGGGTAAAATGCCAATAGATTTAGTGATC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
17117R-2.in silico     361 AACTTCTGTCATCGGTATATATCGTGTTTAAAGGGTAAAATGCCAATAGATTTAGTGATC 420


17117R-2.IR_full       421 GACGAACGGGACACCACCAAACCACCGGAGTTGGGATCGGCGAACGGAGAAGGGCGCAGN 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
17117R-2.in silico     421 GACGAACGGGACACCACCAAACCACCGGAGTTGGGATCGGCGAACGGAGAAGGGCGCAGC 480


17117R-2.IR_full       481 AACGCCGACTCCACATCGCA 500
                           ||||||||||||||||||||
17117R-2.in silico     481 AACGCCGACTCCACATCGCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057229.3  CG17117-RB, transcript variant B (hth), mRNA 
100   482  NM_057228.3  CG17117-RC, transcript variant C (hth), mRNA 
100   482  NM_057230.4  CG17117-RA, transcript variant A (hth), mRNA 
100   482  NM_001014613.2  CG17117-RE, transcript variant E (hth), mRNA 
100   482  NM_001031999.1  CG17117-RF, transcript variant F (hth), mRNA 
100   482  NM_169348.2  CG17117-RD, transcript variant D (hth), mRNA 
0.41   NM_170549.1  CG31204-RA (CG31204), mRNA 
0   NM_058118.3  CG18783-RB, transcript variant B (Kr-h1), mRNA 
0   NM_058119.3  CG18783-RA, transcript variant A (Kr-h1), mRNA 
0   NM_168179.1  CG32394-RA (CG32394), mRNA 
0   NM_176558.1  CG32394-RA (CG32394), mRNA, small, or homeotic discs 2 CG6677-RC, transcript variant C (ash2), mRNA 
0   NM_170159.1  CG32394-RA (CG32394), mRNA, small, or homeotic discs 2 CG6677-RC, transcript variant C (ash2), mRNA, small, or homeotic discs 2 CG6677-RA, transcript variant A (ash2), mRNA 
0   NM_170160.1  CG32394-RA (CG32394), mRNA, small, or homeotic discs 2 CG6677-RC, transcript variant C (ash2), mRNA, small, or homeotic discs 2 CG6677-RA, transcript variant A (ash2), mRNA, small, or homeotic discs 2 CG6677-RB, transcript variant B (ash2), mRNA 
0   NM_143776.3  CG8886-RA, transcript variant A (l(2)05714), mRNA 
0   NM_164605.1  CG8886-RB, transcript variant B (l(2)05714), mRNA 
0   NM_078599.3  CG18657-RA (NetA), mRNA 
0   NM_168325.2  CG4347-RC, transcript variant C (UGP), mRNA 
0   NM_140043.3  CG4347-RA, transcript variant A (UGP), mRNA 
0   NM_135908.2  CG18482-RA (CG18482), mRNA 
0   NM_132066.1  CG4320-RA (raptor), mRNA 
0   10  NM_132122.2  CG3126-RA, transcript variant A (C3G), mRNA 
0   10  NM_176694.1  CG3126-RB, transcript variant B (C3G), mRNA 
0   NM_080144.1  CG15844-RA (Klp54D), mRNA 
0   NM_134961.1  CG10019-RA (CG10019), mRNA 
0   NM_001015338.1  CG40382-PA.3 (CG40382), mRNA 
0   NM_132156.2  CG8300-RA (CG8300), mRNA 
0   NM_137455.4  CG10915-RA (CG10915), mRNA 
0   NM_138141.2  CG3770-RA (CG3770), mRNA 
0   NM_138988.2  CG11405-RA (A3-3), mRNA 
0   NM_001042987.1  CG17704-RE, transcript variant E (Nipped-B), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
DB
+- 
DC
 
DM
VM
VB
 
Caspase-3 signal
N
DB
DC
 
DM
++ 
VM
++ 
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.