National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16998R-2 
 Symbol CG16998  Full Name CG16998 
 CG No CG16998  Old CG No CG16998 
 Synonyms SP104, CG16998 
 Accession No (Link to NCBI) NM_139877.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGTGGCCATAAAACCAGTGCT 
 Primer Seq. 3'
aatctagaggtaccGAGTAAAGTCGCTGGCAAAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGTGGCCATA AAACCAGTGC TTTATCGCCC CAGGAACGGA TCGTGGGTGG AGTAGAGGTG 
0061 CCCATTCATC TTACACCATG GTTGGCTTCG ATCACGGTGC ATGGCAACTA TAGTTGCAGT 
0121 TCGGCATTGA TTACATCACT TTGGTTGGTG ACGGCTGGAC ATTGTGTTCA GTATCCAGAT 
0181 AGCTACTCCG TTCGTGCAGG ATCTACTTTC ACTGATGGTG GTGGTCAGAG AAGGAACGTA 
0241 GTGAGTGTTA TCCTTCATCC AGATTTTAAT CTACGTACTC TGGAAAACGA CATCGCCTTG 
0301 TTGAAGTTAG ATAAATCCTT TACTTTGGGA GAAAATACCT TCAGAGTGGT GAAGCTGCCG 
0361 CTTCCGAGTC TTAATATACT TCCACGAACC CTTTTGGTTG CCGGTTGGGG CAATCCAGAT 
0421 GCCACTGACA GTGAATCGGA ACCTAGACTA CGTGGCACAG TGGTGAAAGT TATTAATCAG 
0481 AGACTTTGCC AGCGACTTTA CTC 
 in silico PCR Fragment
0001 TGTGGCCATA AAACCAGTGC TTTATCGCCC CAGGAACGGA TCGTGGGTGG AGTAGAGGTG 
0061 CCCATTCATC TTACACCATG GTTGGCTTCG ATCACGGTGC ATGGCAACTA TAGTTGCAGT 
0121 TCGGCATTGA TTACATCACT CTGGTTGGTG ACGGCTGGAC ATTGTGTTCA GTATCCAGAT 
0181 AGCTACTCCG TTCGTGCAGG ATCTACTTTC ACTGATGGTG GTGGTCAGAG AAGGAACGTA 
0241 GTGAGTGTTA TCCTTCATCC AGATTTTAAT CTACGTACTC TGGAAAACGA CATCGCCTTG 
0301 TTGAAGTTAG ATAAATCCTT TACTTTGGGA GGAAATA--T TCAG-GTGGT GAAGCTGCCG 
0361 CTTCCGAGTC TTAATATACT TCCACGAACC CTTTTGGTTG CCGGTTGGGG CAATCCAGAT 
0421 GCCACTGACA GTGAATCGGA ACCTAGACTA CGTGGCACAG TGGTGAAAGT TATTAATCAG 
0481 AGACTTTGCC AGCGACTTTA CTC 
 Assemble Data

16998R-2.IR_full       1   TGTGGCCATAAAACCAGTGCTTTATCGCCCCAGGAACGGATCGTGGGTGGAGTAGAGGTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16998R-2.in silico     1   TGTGGCCATAAAACCAGTGCTTTATCGCCCCAGGAACGGATCGTGGGTGGAGTAGAGGTG 60


16998R-2.IR_full       61  CCCATTCATCTTACACCATGGTTGGCTTCGATCACGGTGCATGGCAACTATAGTTGCAGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16998R-2.in silico     61  CCCATTCATCTTACACCATGGTTGGCTTCGATCACGGTGCATGGCAACTATAGTTGCAGT 120


16998R-2.IR_full       121 TCGGCATTGATTACATCACTTTGGTTGGTGACGGCTGGACATTGTGTTCAGTATCCAGAT 180
                           |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
16998R-2.in silico     121 TCGGCATTGATTACATCACTCTGGTTGGTGACGGCTGGACATTGTGTTCAGTATCCAGAT 180


16998R-2.IR_full       181 AGCTACTCCGTTCGTGCAGGATCTACTTTCACTGATGGTGGTGGTCAGAGAAGGAACGTA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16998R-2.in silico     181 AGCTACTCCGTTCGTGCAGGATCTACTTTCACTGATGGTGGTGGTCAGAGAAGGAACGTA 240


16998R-2.IR_full       241 GTGAGTGTTATCCTTCATCCAGATTTTAATCTACGTACTCTGGAAAACGACATCGCCTTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16998R-2.in silico     241 GTGAGTGTTATCCTTCATCCAGATTTTAATCTACGTACTCTGGAAAACGACATCGCCTTG 300


16998R-2.IR_full       301 TTGAAGTTAGATAAATCCTTTACTTTGGGAGAAAATACCTTCAGAGTGGTGAAGCTGCCG 360
                           ||||||||||||||||||||||||||||||| |||||  ||||| |||||||||||||||
16998R-2.in silico     301 TTGAAGTTAGATAAATCCTTTACTTTGGGAGGAAATA--TTCAG-GTGGTGAAGCTGCCG 360


16998R-2.IR_full       361 CTTCCGAGTCTTAATATACTTCCACGAACCCTTTTGGTTGCCGGTTGGGGCAATCCAGAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16998R-2.in silico     361 CTTCCGAGTCTTAATATACTTCCACGAACCCTTTTGGTTGCCGGTTGGGGCAATCCAGAT 420


16998R-2.IR_full       421 GCCACTGACAGTGAATCGGAACCTAGACTACGTGGCACAGTGGTGAAAGTTATTAATCAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16998R-2.in silico     421 GCCACTGACAGTGAATCGGAACCTAGACTACGTGGCACAGTGGTGAAAGTTATTAATCAG 480


16998R-2.IR_full       481 AGACTTTGCCAGCGACTTTACTC 503
                           |||||||||||||||||||||||
16998R-2.in silico     481 AGACTTTGCCAGCGACTTTACTC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139877.1  CG16998-RA (CG16998), mRNA 
0   NM_166313.1  CG30329-RA (Vha100-3), mRNA 
0   NM_079357.2  CG7250-RA (Toll-6), mRNA 
0   NM_206540.1  CG33334-RA (CG33334), mRNA 
0   NM_141442.2  CG2656-RA (CG2656), mRNA 
0   NM_057462.3  CG1916-RA (Wnt2), mRNA 
0   NM_168674.2  CG4118-RB, transcript variant B (nxf2), mRNA 
0   NM_079387.5  CG4118-RA, transcript variant A (nxf2), mRNA 
0   NM_164832.1  CG9280-RC, transcript variant C (Glt), mRNA 
0   NM_164831.1  CG9280-RB, transcript variant B (Glt), mRNA 
0   NM_058156.2  CG9280-RA, transcript variant A (Glt), mRNA 
0   NM_057511.3  CG3936-RA (N), mRNA 
0   NM_079670.2  CG7223-RB, transcript variant B (htl), mRNA 
0   NM_169784.1  CG7223-RA, transcript variant A (htl), mRNA 
0   NM_169785.1  CG7223-RC, transcript variant C (htl), mRNA 
0   NM_142054.1  CG14365-RA (CG14365), mRNA 
0   NM_058021.3  CG2331-RA, transcript variant A (TER94), mRNA 
0   NM_166886.1  CG32808-RA (CG32808), mRNA 
0   NM_080013.2  CG6050-RA (EfTuM), mRNA 
0   NM_057701.3  CG5820-RD, transcript variant D (Gp150), mRNA 
0   NM_057247.3  CG9075-RC, transcript variant C (eIF-4a), mRNA 
0   NM_164669.1  CG9075-RB, transcript variant B (eIF-4a), mRNA 
0   NM_164668.1  CG9075-RA, transcript variant A (eIF-4a), mRNA 
0   NM_164670.1  CG9075-RD, transcript variant D (eIF-4a), mRNA 
0   NM_166529.1  CG5820-RC, transcript variant C (Gp150), mRNA 
0   NM_166527.1  CG5820-RA, transcript variant A (Gp150), mRNA 
0   NM_166528.1  CG5820-RB, transcript variant B (Gp150), mRNA 
0   NM_142342.2  CG31265-RA (CG31265), mRNA 
0   NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
0   NM_141073.1  CG7173-RA (CG7173), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.