National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16997R-3 
 Symbol CG16997  Full Name CG16997 
 CG No CG16997  Old CG No CG16997 
 Synonyms SP147, CG16997 
 Accession No (Link to NCBI) NM_135707.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGACAACAAACCATGTGGCG 
 Primer Seq. 3'
aatctagaggtaccTGCTAGTACTGCCCCAGCCAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGACAACAA ACCATGTGGC GCCATCGCca NCTGGCCACT ATCCTCCTAC TGGCGGTGTG 
0061 CGTTTCCCAA GGATCTGGAT TAGCCTTGGA CCAACCCGAA GGACGCGTTG TGGGTGGAAA 
0121 AGCGGCGACG GCCAATAGTG CTCCGTATAT AGTGTCCATG CAGTACGGAG GAACCCACTA 
0181 TTGCGCCGCT AACATCATTA ATTCCAACTG GCTGGTAACG GCTGCTCACT GTCTGGCCAA 
0241 TAGAAATCAA GTACTTGGAA GCACCCTGGT GGCTGGAAGC ATTGCGGTGG CCGGAACAGC 
0301 GAGCACCACA CAGAAGAGGC AAATCACTTC CACTATGTGA CATCAATGAT CTTTATACCG 
0361 GCGGAACTGT AAAGCCCTAT GGTAAACATC GGATTGATTT ACACGCCCAC CGCCTTCACT 
0421 TGGACCGCTG CTAGTGGCTC CGGTGAAGCT GCCATCGTCC GGCGTGAGGC CAACTGATGA 
0481 AAGGCTGACC TCTTTGGCTG GAATGGCAGT ACTGAGCA 
 in silico PCR Fragment
0001 TGGACAACAA ACCATGTGGC GCCATCGCCA CCTGGCCACT ATCCTCCTGC TGGCGGTGTG 
0061 CGTTTCCCAA GGATCTGGAT TAGCCTTGGA CCAACCCGAA GGACGCGTTG TGGGTGGAAA 
0121 AGCGGCGGCG GCCAATAGTG CTCCGTATAT AGTGTCCATG CAGTACGGAG GAACTCACTA 
0181 TTGCGCCGCT AACATCATTA ATTCCAACTG GCTGGTAACG GCTGCTCACT GCCTGGCCAA 
0241 TAGGAATCAA GTACTTGGAA GCACCCTGGT GGCTGGAAGC ATTGCGGTGG CCGGAACAGC 
0301 GAGCACAACA CAGAAGAGGC AAATCAC--C CACTATGTG- -ATCAATGAT CTTTATACCG 
0361 GCGGAACTGT ---GCCCTAT G----ACATC GGATTGATTT ACACGCCCAC CGCCTTCACT 
0421 TGGACCGCTG C-AGTGGCTC CGGTGAAGCT GCCATCGTCC GGCGTGAGGC CAACTG--GA 
0481 AAGGCTGACC TCTTTGGCTG G---GGCAGT ACT-AGCA 
 Assemble Data

16997R-3.IR_full       1   TGGACAACAAACCATGTGGCGCCATCGCCANCTGGCCACTATCCTCCTACTGGCGGTGTG 60
                           |||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||
16997R-3.in silico     1   TGGACAACAAACCATGTGGCGCCATCGCCACCTGGCCACTATCCTCCTGCTGGCGGTGTG 60


16997R-3.IR_full       61  CGTTTCCCAAGGATCTGGATTAGCCTTGGACCAACCCGAAGGACGCGTTGTGGGTGGAAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16997R-3.in silico     61  CGTTTCCCAAGGATCTGGATTAGCCTTGGACCAACCCGAAGGACGCGTTGTGGGTGGAAA 120


16997R-3.IR_full       121 AGCGGCGACGGCCAATAGTGCTCCGTATATAGTGTCCATGCAGTACGGAGGAACCCACTA 180
                           ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||
16997R-3.in silico     121 AGCGGCGGCGGCCAATAGTGCTCCGTATATAGTGTCCATGCAGTACGGAGGAACTCACTA 180


16997R-3.IR_full       181 TTGCGCCGCTAACATCATTAATTCCAACTGGCTGGTAACGGCTGCTCACTGTCTGGCCAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
16997R-3.in silico     181 TTGCGCCGCTAACATCATTAATTCCAACTGGCTGGTAACGGCTGCTCACTGCCTGGCCAA 240


16997R-3.IR_full       241 TAGAAATCAAGTACTTGGAAGCACCCTGGTGGCTGGAAGCATTGCGGTGGCCGGAACAGC 300
                           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16997R-3.in silico     241 TAGGAATCAAGTACTTGGAAGCACCCTGGTGGCTGGAAGCATTGCGGTGGCCGGAACAGC 300


16997R-3.IR_full       301 GAGCACCACACAGAAGAGGCAAATCACTTCCACTATGTGACATCAATGATCTTTATACCG 360
                           |||||| ||||||||||||||||||||  ||||||||||  |||||||||||||||||||
16997R-3.in silico     301 GAGCACAACACAGAAGAGGCAAATCAC--CCACTATGTG--ATCAATGATCTTTATACCG 360


16997R-3.IR_full       361 GCGGAACTGTAAAGCCCTATGGTAAACATCGGATTGATTTACACGCCCACCGCCTTCACT 420
                           ||||||||||   ||||||||    |||||||||||||||||||||||||||||||||||
16997R-3.in silico     361 GCGGAACTGT---GCCCTATG----ACATCGGATTGATTTACACGCCCACCGCCTTCACT 420


16997R-3.IR_full       421 TGGACCGCTGCTAGTGGCTCCGGTGAAGCTGCCATCGTCCGGCGTGAGGCCAACTGATGA 480
                           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||  ||
16997R-3.in silico     421 TGGACCGCTGC-AGTGGCTCCGGTGAAGCTGCCATCGTCCGGCGTGAGGCCAACTG--GA 480


16997R-3.IR_full       481 AAGGCTGACCTCTTTGGCTGGAATGGCAGTACTGAGCA 518
                           |||||||||||||||||||||   ||||||||| ||||
16997R-3.in silico     481 AAGGCTGACCTCTTTGGCTGG---GGCAGTACT-AGCA 518

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135707.1  CG16997-RA (CG16997), mRNA 
2.48   12  16  51  54  NM_135706.2  CG16996-RA (CG16996), mRNA 
0   NM_078526.1  CG10759-RA (Or7a), mRNA 
0   16  12  NM_132977.1  CG12997-RA (CG12997), mRNA 
0   NM_137449.2  CG5661-RA (Sema-5c), mRNA 
0   NM_144033.2  CG10987-RA (CG10987), mRNA 
0   NM_080111.2  CG2684-RA (lds), mRNA 
0   NM_163886.1  CG32491-RP, transcript variant P (mod(mdg4)), mRNA 
0   NM_141139.1  CG12377-RA (CG12377), mRNA 
0   NM_176727.1  CG33174-RD, transcript variant D (CG33174), mRNA 
0   NM_176728.1  CG33174-RA, transcript variant A (CG33174), mRNA 
0   NM_141880.2  CG10005-RA (CG10005), mRNA 
0   NM_165235.1  CG31740-RA (CG31740), mRNA 
0   NM_057956.2  CG10269-RA (D19A), mRNA 
0   NM_140493.2  CG16959-RA, transcript variant A (CG16959), mRNA 
0   NM_168608.1  CG16959-RB, transcript variant B (CG16959), mRNA 
0   NM_139418.1  CG1887-RA (CG1887), mRNA 
0   NM_001042863.1  CG7337-RB, transcript variant B (CG7337), mRNA 
0   NM_001042862.1  CG7337-RC, transcript variant C (CG7337), mRNA 
0   NM_134786.4  CG7337-RA, transcript variant A (CG7337), mRNA 
0   NM_169091.1  CG1109-RA, transcript variant A (CG1109), mRNA 
0   NM_169092.1  CG1109-RB, transcript variant B (CG1109), mRNA 
0   NM_140737.1  CG6298-RA (Jon74E), mRNA 
0   NM_164501.1  CG3139-RB, transcript variant B (syt), mRNA 
0   NM_078736.2  CG3139-RA, transcript variant A (syt), mRNA 
0   NM_205897.1  CG3139-RD, transcript variant D (syt), mRNA 
0   NM_132118.2  CG3203-RD, transcript variant D (RpL17), mRNA 
0   NM_164502.1  CG3139-RC, transcript variant C (syt), mRNA 
0   NM_079787.2  CG6096-RA (HLHm5), mRNA 
0   NR_002547.1  CG6096-RA (HLHm5), mRNA, miscRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.