National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16996R-1 
 Symbol CG16996  Full Name CG16996 
 CG No CG16996  Old CG No CG16996 
 Synonyms SP134, CG16996 
 Accession No (Link to NCBI) NM_135706.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACAAAGTCGTTGGCCAGTGGG 
 Primer Seq. 3'
aatctagaggtaccGGATAGGAGGCGGTATTCGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACAAAGTCGT TGGCCAGTGG GCTCCTTCTC CTACTGGGCA TATGCCGAAT ATCCGGAGTG 
0061 GCTATCGGCG CACCCGAGGG GCGTGTCGTG GGTGGATCTC CAGCGGCGGT GAATAGTGCT 
0121 CCCTATGCGG TGTCCATGCA GTACGGTGGC ACCCATTACT GTGCCGCCAG CATTCTGAAT 
0181 GCCAACTGGC TGGTCACCGC TGCCCACTGC CTGACCAATA GTANACCAGG TGCTGGGCAG 
0241 CACCTTGGTG GCCGGAAGCA TCGCGGTGGA CGGAACTGCA AGCACTACGC AGACGCGGAG 
0301 CATCACGTAC TTCGTGATCA ATGACTTGTA CACCGGCGGA ACTGTGCCCT ATGACATCGG 
0361 AATGATCTAC ACGCCCACCG CCTTCGTTTG GAGcGCCGcC GTTGCCCCAG TGACGCTACC 
0421 ATCCTCGGGA gNGNTGcCCA CTgGCACCGC CAATCTGTAC GGATGGGGCA GCACTAGCAC 
0481 CACGAATACC GCCTNCTATC C 
 in silico PCR Fragment
0001 ACAAAGTCGT TGGCCAGTGG GCTTCTTCTC CTACTGGGCA TATGCCGAAT ATCCGGAGTG 
0061 GCTATCGGCG CACCCGAGGG GCGTGTCGTG GGTGGATCTC CGGCAGCGGT GAATAGTGCT 
0121 CCCTATGCGG TGTCCATGCA GTACGGTGGC ACCCATTACT GTGCCGCCAG CATTCTGAAT 
0181 GCCAACTGGC TAGTCACCGC TGCCCACTGC CTGACCAATA GTA-ACCAGG TGCTGGGCAG 
0241 CACCTTGGTG GCCGGAAGCA TCGCGGTGGA CGGAACTGCA AGCACTACGC AGACGCGGAG 
0301 CATCACGTAC TTCGTGATCA ATGACTTGTA CACCGGCGGA ACTGTGCCCT ATGACATCGG 
0361 AATGATCTAC ACGCCCACCG CCTTCGTTTG GAGCGCCGCC GTTGCCCCAG TGACGCTACC 
0421 ATCCTCGGGA GTGGTGCCCA CTGGCACCGC CAATCTGTAC GGATGGGGCA GCACTAGCAC 
0481 CACGAATACC GCCTCCTATC C 
 Assemble Data

16996R-1.IR_full       1   ACAAAGTCGTTGGCCAGTGGGCTCCTTCTCCTACTGGGCATATGCCGAATATCCGGAGTG 60
                           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
16996R-1.in silico     1   ACAAAGTCGTTGGCCAGTGGGCTTCTTCTCCTACTGGGCATATGCCGAATATCCGGAGTG 60


16996R-1.IR_full       61  GCTATCGGCGCACCCGAGGGGCGTGTCGTGGGTGGATCTCCAGCGGCGGTGAATAGTGCT 120
                           ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||
16996R-1.in silico     61  GCTATCGGCGCACCCGAGGGGCGTGTCGTGGGTGGATCTCCGGCAGCGGTGAATAGTGCT 120


16996R-1.IR_full       121 CCCTATGCGGTGTCCATGCAGTACGGTGGCACCCATTACTGTGCCGCCAGCATTCTGAAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16996R-1.in silico     121 CCCTATGCGGTGTCCATGCAGTACGGTGGCACCCATTACTGTGCCGCCAGCATTCTGAAT 180


16996R-1.IR_full       181 GCCAACTGGCTGGTCACCGCTGCCCACTGCCTGACCAATAGTANACCAGGTGCTGGGCAG 240
                           ||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||
16996R-1.in silico     181 GCCAACTGGCTAGTCACCGCTGCCCACTGCCTGACCAATAGTA-ACCAGGTGCTGGGCAG 240


16996R-1.IR_full       241 CACCTTGGTGGCCGGAAGCATCGCGGTGGACGGAACTGCAAGCACTACGCAGACGCGGAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16996R-1.in silico     241 CACCTTGGTGGCCGGAAGCATCGCGGTGGACGGAACTGCAAGCACTACGCAGACGCGGAG 300


16996R-1.IR_full       301 CATCACGTACTTCGTGATCAATGACTTGTACACCGGCGGAACTGTGCCCTATGACATCGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16996R-1.in silico     301 CATCACGTACTTCGTGATCAATGACTTGTACACCGGCGGAACTGTGCCCTATGACATCGG 360


16996R-1.IR_full       361 AATGATCTACACGCCCACCGCCTTCGTTTGGAGCGCCGCCGTTGCCCCAGTGACGCTACC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16996R-1.in silico     361 AATGATCTACACGCCCACCGCCTTCGTTTGGAGCGCCGCCGTTGCCCCAGTGACGCTACC 420


16996R-1.IR_full       421 ATCCTCGGGAGNGNTGCCCACTGGCACCGCCAATCTGTACGGATGGGGCAGCACTAGCAC 480
                           ||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||
16996R-1.in silico     421 ATCCTCGGGAGTGGTGCCCACTGGCACCGCCAATCTGTACGGATGGGGCAGCACTAGCAC 480


16996R-1.IR_full       481 CACGAATACCGCCTNCTATCC 501
                           |||||||||||||| ||||||
16996R-1.in silico     481 CACGAATACCGCCTCCTATCC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135706.2  CG16996-RA (CG16996), mRNA 
2.48   12  16  51  64  NM_135707.1  CG16997-RA (CG16997), mRNA 
0   NM_168001.1  CG32271-RA (CG32271), mRNA 
0   NM_140082.1  CG8329-RA (CG8329), mRNA 
0   NM_138066.2  CG15873-RA (CG15873), mRNA 
0   NM_167884.1  CG1009-RE, transcript variant E (Psa), mRNA 
0   NM_167883.1  CG1009-RC, transcript variant C (Psa), mRNA 
0   NM_167887.1  CG1009-RF, transcript variant F (Psa), mRNA 
0   NM_167886.1  CG1009-RD, transcript variant D (Psa), mRNA 
0   NM_167885.1  CG1009-RA, transcript variant A (Psa), mRNA 
0   NM_139360.2  CG1009-RB, transcript variant B (Psa), mRNA 
0   NM_001038864.1  CG4927-RC (CG4927), mRNA 
0   NM_143209.1  CG6142-RA (CG6142), mRNA 
0   NM_132141.1  CG14431-RA (CG14431), mRNA 
0   NM_144395.3  CG18754-RA (CG18754), mRNA 
0   NM_078533.1  CG11213-RA (Cp38), mRNA 
0   NM_137200.2  CG30467-RA (CG30467), mRNA 
0   NM_135917.2  CG18480-RA (CG18480), mRNA 
0   NM_079703.2  CG3593-RA (r-l), mRNA 
0   NM_164794.1  CG31900-RA (CG31900), mRNA 
0   NM_166745.1  CG31999-RA (CG31999), mRNA 
0   NM_141431.1  CG1105-RA (CG1105), mRNA 
0   NM_135457.1  CG4382-RA (CG4382), mRNA 
0   NM_140118.1  CG12524-RA (CG12524), mRNA 
0   NM_136875.2  CG17509-RA (CG17509), mRNA 
0   NM_135871.2  CG3473-RA (CG3473), mRNA 
0   NM_143996.1  CG13643-RA (CG13643), mRNA 
0   NM_079153.3  CG13888-RA (Gr61a), mRNA 
0   NM_206424.1  CG7448-RB, transcript variant B (CG7448), mRNA 
0   NM_134719.2  CG4428-RA (Atg4), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.