National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16987R-2 
 Symbol Alp23B  Full Name Activin Like Protein at 23B 
 CG No CG16987  Old CG No CG16987 
 Synonyms CG16987, Alp23b, Alp, ALP23B, Alp23B 
 Accession No (Link to NCBI) NM_078737.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Eusebio N, Tavares L, Pereira PS.
CtBP represses Dpp-dependent Mad activation during Drosophila eye development.
Dev Biol (2018) 442(1) 188-198 [ PubMed ID = 30031756 ] [ RRC reference ]

Hevia CF, de Celis JF.
Activation and function of TGFβ signalling during Drosophila wing development and its interactions with the BMP pathway.
Dev Biol (2013) 377(1) 138-53 [ PubMed ID = 23485686 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGTGTTGCTGGTGTGTCTGG 
 Primer Seq. 3'
aatctagaggtaccCGGCGACAGATCATCAAAGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGTGTTGCT GGTGTGTCTG GCCCTGGAGA ACAGGAACGT ATACAATCGC CTGCACGCCC 
0061 GCTCCCATCC GAGTTCCCGT GGCGACATCC TTCGTCCGCA TCCTAAGCAC CAGCCGCATC 
0121 CCCATGTGCA GCACACCTCG CAACAGCTGC AGCAGCAACA CCATATCCGG CAGCAACGAT 
0181 CCCGTCAGCT GAAACACCTG GAACCGGATC CGACCAGCGA GGAGGACGAT GTACCGATCA 
0241 CCAAGCGGGA GTACTATGCC CGCCTGAGGC GCCACGTCAT CCACAAGAGG CAGCACCTCC 
0301 TGCAGCAGGA GCTCAGCTAC AACCATCCCG GCTCCCATTC GGAGCAGCTA ANAGGTGCCC 
0361 CGCCTGTGGC AACACCTCAT GGAGCAGGAG GAGAAGGCAC ACCGACATGT GAGCCCGCCC 
0421 GTGGAGTTGC CTATCATGTA CGGAGATGCC CCCGAGGAGT CATCCCTCTC CTCCGATGAT 
0481 CACTTTGATG ATCTGTCGCC G 
 in silico PCR Fragment
0001 TGGTGTTGCT GGTGTGTCTG GCCCTGGAGA ACAGGAACGT ATACAATCGC CTGCACGCCC 
0061 GCTCCCATCC GAGTTCCCGT GGCGACATCC TTCGTCCGCA TCCTAAGCAC CAGCCGCATC 
0121 CCCATGTGCA GCACACCTCG CAACAGCTGC AGCAGCAACA CCATATCCGG CAGCAACGAT 
0181 CCCGTCAGCT GAAACACCTG GAACCGGATC CGACCAGCGA GGAGGACGAT GTACCGATCA 
0241 CCAAGCGGGA GTACTATGCC CGCCTGAGGC GCCACGTCAT CCACAAGAGG CAGCACCTCC 
0301 TGCAGCAGGA GCTCAGCTAC AACCATCCCG GCTCCCATTC GGAGCAGCTA A-AGGTGCCC 
0361 CGCCTGTGGC AACACCTCAT GGAGCAGGAG GAGAAGGCAC ACCGACATGT GAGCCCGCCC 
0421 GTGGAGTTGC CTATCATGTA CGGAGATGCC CCCGAGGAGT CATCCCTCTC CTCCGATGAT 
0481 CACTTTGATG ATCTGTCGCC G 
 Assemble Data

16987R-2.IR_full       1   TGGTGTTGCTGGTGTGTCTGGCCCTGGAGAACAGGAACGTATACAATCGCCTGCACGCCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16987R-2.in silico     1   TGGTGTTGCTGGTGTGTCTGGCCCTGGAGAACAGGAACGTATACAATCGCCTGCACGCCC 60


16987R-2.IR_full       61  GCTCCCATCCGAGTTCCCGTGGCGACATCCTTCGTCCGCATCCTAAGCACCAGCCGCATC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16987R-2.in silico     61  GCTCCCATCCGAGTTCCCGTGGCGACATCCTTCGTCCGCATCCTAAGCACCAGCCGCATC 120


16987R-2.IR_full       121 CCCATGTGCAGCACACCTCGCAACAGCTGCAGCAGCAACACCATATCCGGCAGCAACGAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16987R-2.in silico     121 CCCATGTGCAGCACACCTCGCAACAGCTGCAGCAGCAACACCATATCCGGCAGCAACGAT 180


16987R-2.IR_full       181 CCCGTCAGCTGAAACACCTGGAACCGGATCCGACCAGCGAGGAGGACGATGTACCGATCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16987R-2.in silico     181 CCCGTCAGCTGAAACACCTGGAACCGGATCCGACCAGCGAGGAGGACGATGTACCGATCA 240


16987R-2.IR_full       241 CCAAGCGGGAGTACTATGCCCGCCTGAGGCGCCACGTCATCCACAAGAGGCAGCACCTCC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16987R-2.in silico     241 CCAAGCGGGAGTACTATGCCCGCCTGAGGCGCCACGTCATCCACAAGAGGCAGCACCTCC 300


16987R-2.IR_full       301 TGCAGCAGGAGCTCAGCTACAACCATCCCGGCTCCCATTCGGAGCAGCTAANAGGTGCCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
16987R-2.in silico     301 TGCAGCAGGAGCTCAGCTACAACCATCCCGGCTCCCATTCGGAGCAGCTAA-AGGTGCCC 360


16987R-2.IR_full       361 CGCCTGTGGCAACACCTCATGGAGCAGGAGGAGAAGGCACACCGACATGTGAGCCCGCCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16987R-2.in silico     361 CGCCTGTGGCAACACCTCATGGAGCAGGAGGAGAAGGCACACCGACATGTGAGCCCGCCC 420


16987R-2.IR_full       421 GTGGAGTTGCCTATCATGTACGGAGATGCCCCCGAGGAGTCATCCCTCTCCTCCGATGAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16987R-2.in silico     421 GTGGAGTTGCCTATCATGTACGGAGATGCCCCCGAGGAGTCATCCCTCTCCTCCGATGAT 480


16987R-2.IR_full       481 CACTTTGATGATCTGTCGCCG 501
                           |||||||||||||||||||||
16987R-2.in silico     481 CACTTTGATGATCTGTCGCCG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  13  NM_164503.1  CG16987-RB, transcript variant B (Alp23B), mRNA 
100   482  13  NM_078737.2  CG16987-RA, transcript variant A (Alp23B), mRNA 
0.62   10  23  69  NM_132004.2  CG4136-RA (CG4136), mRNA 
0.62   14  56  NM_132412.1  CG9817-RA (CG9817), mRNA 
0.62   NM_169950.1  CG17299-RG, transcript variant G (SNF4Agamma), mRNA 
0.62   NM_001043271.1  CG17299-RL, transcript variant L (SNF4Agamma), mRNA 
0.41   17  40  NM_131964.1  CG15470-RA (CG15470), mRNA 
0.41   30  87  NM_130541.3  CG3638-RC, transcript variant C (CG3638), mRNA 
0.41   30  87  NM_166872.1  CG3638-RD, transcript variant D (CG3638), mRNA 
0.41   30  86  NM_166874.1  CG3638-RA, transcript variant A (CG3638), mRNA 
0.41   30  86  NM_166873.1  CG3638-RB, transcript variant B (CG3638), mRNA 
0.41   NM_001038758.1  CG9908-RB, transcript variant B (disco), mRNA 
0.41   NM_078638.2  CG9908-RA, transcript variant A (disco), mRNA 
0.2   26  52  87  NM_132525.1  CG15740-RA (CG15740), mRNA 
0.2   36  105  NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 
0.2   36  105  NM_079853.2  CG15532-RA, transcript variant A (hdc), mRNA 
0.2   23  70  NM_170478.1  CG15532-RB, transcript variant B (hdc), mRNA 
0.2   10  26  NM_145757.2  CG30084-RC, transcript variant C (CG30084), mRNA 
0.2   21  NM_137214.3  CG30084-RA, transcript variant A (CG30084), mRNA 
0.2   NM_176032.1  CG33115-RA (CG33115), mRNA 
0   19  156  529  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   19  156  529  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   19  156  529  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   11  32  97  NM_206286.1  CG10107-RC, transcript variant C (CG10107), mRNA 
0   11  32  97  NM_139799.3  CG10107-RA, transcript variant A (CG10107), mRNA 
0   10  67  254  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0   10  67  254  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0   10  43  111  NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
0   10  43  111  NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
0   10  43  111  NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.