National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16858R-1 
 Symbol vkg  Full Name viking 
 CG No CG16858  Old CG No CG16858 
 Synonyms vkg, CT25584, alpha(IV)2/vkg, DmColA2, 6072, 1209, l(2)01209, CG16858, coll. IV 
 Accession No (Link to NCBI) NM_057842.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ríos-Barrera LD, Sigurbjörnsdóttir S, Baer M, Leptin M.
Dual function for Tango1 in secretion of bulky cargo and in ER-Golgi morphology.
Proc. Natl. Acad. Sci. U.S.A. (2017) 114(48) E10389-E10398 [ PubMed ID = 29138315 ] [ RRC reference ]

Junion G, Bataillé L, Jagla T, Da Ponte JP, Tapin R, Jagla K.
Genome-wide view of cell fate specification: ladybird acts at multiple levels during diversification of muscle and heart precursors.
Genes Dev. (2007) 21(23) 3163-80 [ PubMed ID = 18056427 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCGGCATCAACTCCAAGGGCA 
 Primer Seq. 3'
aatctagaggtaccTGGGCTTCCGTCCAATCCATC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 gCGGTCATCA ACTCCAAGGG CACCAAGGGC AATCGGGGCG AGACTGGACA GCCTGGcGNT 
0061 GTGGGACcgC CCGGATTCGA TGGCGATCNC GGNAGcAANG GTGACACTGG ATATGCTGGC 
0121 CTAACTGGCG AGAAGGGAGA tCCAGGACTG CCTGGACCCA AGGGTGACAC TGGCGCCGTT 
0181 TCGGAGCTGC CATACTCACT GATTGGACCA CCTGGCGCCA AGGGTGAGCC AGGTGACAGC 
0241 CTATCCGGAG TGCTGAAGCC AGACGACACC TTGAAGGGTT ACAAGGGATA TGTGGGACTC 
0301 CAGGGTGATG AGGGGCCACA GGGACCGACC GGCGAACAAG GCGCCGTTGG ACGTAATGGA 
0361 TTGCCCGGTG CAAGAGGTGA GATCGGTGGA CCCGGAGAGC GCGGCAAGCC CGGTAAGGAT 
0421 GGTGAACCCG GTCGATTCGG AGACAAGGGC ATGAAGGGTT GCGCCCGGCT GGACTGGAGC 
0481 TGATGGAtTG GACGGAAGCC CA 
 in silico PCR Fragment
0001 GCGG-CATCA ACTCCAAGGG CACCAAGGGC AATCGGGGCG AGACTGGACA GCCTGGCGGT 
0061 GTGGGACCGC CCGGATTCGA TGGCGATCGC GGTAGCAAGG GTGACACTGG ATATGCTGGC 
0121 CTAACTGGCG AGAAGGGAGA TCCAGGACTG CCTGGACCCA AGGGTGACAC TGGCGCCGTT 
0181 TCGGAGCTGC CATACTCACT GATTGGACCA CCTGGCGCCA AGGGTGAGCC AGGTGACAGC 
0241 CTATCCGGAG TGCTGAAGCC AGACGACACC TTGAAGGGTT ACAAGGGATA TGTGGGACTC 
0301 CAGGGTGATG AGGGGCCACA GGGACCGACC GGCGAACAAG GCGCCGTTGG ACGTAATGGA 
0361 TTGCCCGGTG CAAGAGGTGA GATCGGTGGA CCCGGAGAGC GCGGCAAGCC CGGTAAGGAT 
0421 GGTGAACCCG GTCGATTCGG AGACAAGGGC ATGAAGGG-T GCGCCCGGCT GGACTGGAGC 
0481 TGATGGATTG GACGGAAGCC CA 
 Assemble Data

16858R-1.IR_full       1   GCGGTCATCAACTCCAAGGGCACCAAGGGCAATCGGGGCGAGACTGGACAGCCTGGCGNT 60
                           |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
16858R-1.in silico     1   GCGG-CATCAACTCCAAGGGCACCAAGGGCAATCGGGGCGAGACTGGACAGCCTGGCGGT 60


16858R-1.IR_full       61  GTGGGACCGCCCGGATTCGATGGCGATCNCGGNAGCAANGGTGACACTGGATATGCTGGC 120
                           |||||||||||||||||||||||||||| ||| ||||| |||||||||||||||||||||
16858R-1.in silico     61  GTGGGACCGCCCGGATTCGATGGCGATCGCGGTAGCAAGGGTGACACTGGATATGCTGGC 120


16858R-1.IR_full       121 CTAACTGGCGAGAAGGGAGATCCAGGACTGCCTGGACCCAAGGGTGACACTGGCGCCGTT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16858R-1.in silico     121 CTAACTGGCGAGAAGGGAGATCCAGGACTGCCTGGACCCAAGGGTGACACTGGCGCCGTT 180


16858R-1.IR_full       181 TCGGAGCTGCCATACTCACTGATTGGACCACCTGGCGCCAAGGGTGAGCCAGGTGACAGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16858R-1.in silico     181 TCGGAGCTGCCATACTCACTGATTGGACCACCTGGCGCCAAGGGTGAGCCAGGTGACAGC 240


16858R-1.IR_full       241 CTATCCGGAGTGCTGAAGCCAGACGACACCTTGAAGGGTTACAAGGGATATGTGGGACTC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16858R-1.in silico     241 CTATCCGGAGTGCTGAAGCCAGACGACACCTTGAAGGGTTACAAGGGATATGTGGGACTC 300


16858R-1.IR_full       301 CAGGGTGATGAGGGGCCACAGGGACCGACCGGCGAACAAGGCGCCGTTGGACGTAATGGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16858R-1.in silico     301 CAGGGTGATGAGGGGCCACAGGGACCGACCGGCGAACAAGGCGCCGTTGGACGTAATGGA 360


16858R-1.IR_full       361 TTGCCCGGTGCAAGAGGTGAGATCGGTGGACCCGGAGAGCGCGGCAAGCCCGGTAAGGAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16858R-1.in silico     361 TTGCCCGGTGCAAGAGGTGAGATCGGTGGACCCGGAGAGCGCGGCAAGCCCGGTAAGGAT 420


16858R-1.IR_full       421 GGTGAACCCGGTCGATTCGGAGACAAGGGCATGAAGGGTTGCGCCCGGCTGGACTGGAGC 480
                           |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
16858R-1.in silico     421 GGTGAACCCGGTCGATTCGGAGACAAGGGCATGAAGGG-TGCGCCCGGCTGGACTGGAGC 480


16858R-1.IR_full       481 TGATGGATTGGACGGAAGCCCA 502
                           ||||||||||||||||||||||
16858R-1.in silico     481 TGATGGATTGGACGGAAGCCCA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  16  67  NM_057842.2  CG16858-RA (vkg), mRNA 
0   24  143  NM_164617.1  CG4145-RC, transcript variant C (Cg25C), mRNA 
0   24  143  NM_164616.1  CG4145-RB, transcript variant B (Cg25C), mRNA 
0   24  143  NM_164615.1  CG4145-RA, transcript variant A (Cg25C), mRNA 
0   NM_205955.3  CG33301-RA (CG33301), mRNA 
0   NM_138216.1  CG13886-RA (CG13886), mRNA 
0   NM_078706.2  CG1403-RA, transcript variant A (Sep1), mRNA 
0   NM_166570.1  CG30187-RA (CG30187), mRNA 
0   NM_057981.3  CG4063-RA (ebi), mRNA 
0   NR_002024.1  CG4063-RA (ebi), mRNA, miscRNA 
0   NM_058003.3  CG5216-RA (Sir2), mRNA 
0   NM_057412.3  CG10223-RA (Top2), mRNA 
0   NM_169748.1  CG31269-RA (CG31269), mRNA 
0   29  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_001031899.1  CG33639-RA (CG33639), mRNA 
0   12  NM_206051.1  CG2105-RB, transcript variant B (Corin), mRNA 
0   12  NM_136453.1  CG2105-RA, transcript variant A (Corin), mRNA 
0   NM_079738.2  CG6768-RA (DNApol-epsilon), mRNA 
0   NM_143377.2  CG1646-RA, transcript variant A (CG1646), mRNA 
0   NM_132488.3  CG11727-RB, transcript variant B (CG11727), mRNA 
0   NM_001038894.1  CG33965-RA (CG33965), mRNA 
0   NM_176576.1  CG1646-RC, transcript variant C (CG1646), mRNA 
0   NM_167285.2  CG11727-RA, transcript variant A (CG11727), mRNA 
0   NM_176577.1  CG1646-RD, transcript variant D (CG1646), mRNA 
0   NM_170377.1  CG1646-RB, transcript variant B (CG1646), mRNA 
0   NM_167481.2  CG9209-RA, transcript variant A (vap), mRNA 
0   NM_001042873.1  CG31651-RB, transcript variant B (pgant5), mRNA 
0   NM_167480.1  CG9209-RC, transcript variant C (vap), mRNA 
0   NM_206759.1  CG9209-RD, transcript variant D (vap), mRNA 
0   NM_165989.1  CG30061-RA (CG30061), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.