National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16827R-2 
 Symbol alphaPS4  Full Name alphaPS4 
 CG No CG16827  Old CG No CG16827 
 Synonyms alpha-ps4, CT37393, alphaPS4, CG16827 
 Accession No (Link to NCBI) NM_137181.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kim MJ, Choe KM.
Basement membrane and cell integrity of self-tissues in maintaining Drosophila immunological tolerance.
PLoS Genet (2014) 10(10) e1004683 [ PubMed ID = 25329560 ] [ RRC reference ]

Nonaka S, Nagaosa K, Mori T, Shiratsuchi A, Nakanishi Y.
Integrin αPS3/βν-mediated phagocytosis of apoptotic cells and bacteria in Drosophila.
J Biol Chem (2013) 288(15) 10374-80 [ PubMed ID = 23426364 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCTCCGCGTTTCTACAGTAT 
 Primer Seq. 3'
aatctagaggtaccCCTCGCCAAATTGGTTATTGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGCTCCGcGN NTCTACAGTA TTAATAATGA AAACGACTAT AATAATGGGA TGTGCTACTG 
0061 GTTAAGTGAC ACACCTAAGA ATATCGATTC CACAGAGGTG ATGGAAAAGT GGCCTCTTAG 
0121 AATAGAAAAG AAACAAGTGC TTAAACTAGC AGACACGAAT TTAATCCCAT ACTACTCGAT 
0181 GGGTGAACTN GGGACTGAGT GCACATGTGT CGGATGATAA CTCGAAGCTT TTGATGGGTG 
0241 CACCGGGAAT TGATCAGTGG AAGGGATCAG TGCACTTAAA ACAGGAAGTG CCAAGCATTA 
0301 AAACATCGAG TGGAAGACAA AGGCGTGGGA TGAACACTAA TAGAAAATGT AACGAGTGTA 
0361 ACCCAGAGCC AAAAAATTTT GGACAGGAGG AATTCTCATA CTTTGGGTAC GCCGTGAGCT 
0421 CCGGCTACTT TGATAGTTCC AACCTAAGCA CAGTGCTTTA TGTGGCCACC GCTCCTCGAG 
0481 GCAATAACCA ATTTGGCGAG G 
 in silico PCR Fragment
0001 CGCTCCGCGT TTCTACAGTA TTAATAATGA AAACGACTAT AATAATGGGA TGTGCTACTG 
0061 GTTAAGTGAC ACACCTAAGA ATATCGATTC CACAGAGGTG ATGGAAAAGT GGCCTCTTAG 
0121 AATAGAAAAG AAACAAGTGC TTAAACTAGC AGACACGAAT TTAATCCCAT ACTACTCGAT 
0181 GGGTGAACT- GGGACTGAGT GCACATGTGT CGGATGATAA CTCGAAGCTT TTGATGGGTG 
0241 CACCGGGAAT TGATCAGTGG AAGGGATCAG TGCACTTAAA ACAGGAAGTG CCAAGCATTA 
0301 AAACATCGAG TGGAAGACAA AGGCGTGGGA TGAACACTAA TAGAAAATGT AACGAGTGTA 
0361 ACCCAGAGCC AAAAAATTTT GGACAGGAGG AATTCTCATA CTTTGGGTAC GCCGTGAGCT 
0421 CCGGCTACTT TGATAGTTCC AACCTAAGCA CAGTGCTTTA TGTGGCCACC GCTCCTCGAG 
0481 GCAATAACCA ATTTGGCGAG G 
 Assemble Data

16827R-2.IR_full       1   CGCTCCGCGNNTCTACAGTATTAATAATGAAAACGACTATAATAATGGGATGTGCTACTG 60
                           |||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||
16827R-2.in silico     1   CGCTCCGCGTTTCTACAGTATTAATAATGAAAACGACTATAATAATGGGATGTGCTACTG 60


16827R-2.IR_full       61  GTTAAGTGACACACCTAAGAATATCGATTCCACAGAGGTGATGGAAAAGTGGCCTCTTAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16827R-2.in silico     61  GTTAAGTGACACACCTAAGAATATCGATTCCACAGAGGTGATGGAAAAGTGGCCTCTTAG 120


16827R-2.IR_full       121 AATAGAAAAGAAACAAGTGCTTAAACTAGCAGACACGAATTTAATCCCATACTACTCGAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16827R-2.in silico     121 AATAGAAAAGAAACAAGTGCTTAAACTAGCAGACACGAATTTAATCCCATACTACTCGAT 180


16827R-2.IR_full       181 GGGTGAACTNGGGACTGAGTGCACATGTGTCGGATGATAACTCGAAGCTTTTGATGGGTG 240
                           ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
16827R-2.in silico     181 GGGTGAACT-GGGACTGAGTGCACATGTGTCGGATGATAACTCGAAGCTTTTGATGGGTG 240


16827R-2.IR_full       241 CACCGGGAATTGATCAGTGGAAGGGATCAGTGCACTTAAAACAGGAAGTGCCAAGCATTA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16827R-2.in silico     241 CACCGGGAATTGATCAGTGGAAGGGATCAGTGCACTTAAAACAGGAAGTGCCAAGCATTA 300


16827R-2.IR_full       301 AAACATCGAGTGGAAGACAAAGGCGTGGGATGAACACTAATAGAAAATGTAACGAGTGTA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16827R-2.in silico     301 AAACATCGAGTGGAAGACAAAGGCGTGGGATGAACACTAATAGAAAATGTAACGAGTGTA 360


16827R-2.IR_full       361 ACCCAGAGCCAAAAAATTTTGGACAGGAGGAATTCTCATACTTTGGGTACGCCGTGAGCT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16827R-2.in silico     361 ACCCAGAGCCAAAAAATTTTGGACAGGAGGAATTCTCATACTTTGGGTACGCCGTGAGCT 420


16827R-2.IR_full       421 CCGGCTACTTTGATAGTTCCAACCTAAGCACAGTGCTTTATGTGGCCACCGCTCCTCGAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
16827R-2.in silico     421 CCGGCTACTTTGATAGTTCCAACCTAAGCACAGTGCTTTATGTGGCCACCGCTCCTCGAG 480


16827R-2.IR_full       481 GCAATAACCAATTTGGCGAGG 501
                           |||||||||||||||||||||
16827R-2.in silico     481 GCAATAACCAATTTGGCGAGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137181.1  CG16827-RA (alphaPS4), mRNA 
0   15  41  NM_079026.2  CG8095-RB, transcript variant B (scb), mRNA 
0   15  41  NM_166083.1  CG8095-RA, transcript variant A (scb), mRNA 
0   NM_166732.2  CG32000-RB, transcript variant B (CG32000), mRNA 
0   NM_205865.1  CG32000-RG, transcript variant G (CG32000), mRNA 
0   NM_166730.2  CG32000-RA, transcript variant A (CG32000), mRNA 
0   NM_135288.2  CG18585-RA (CG18585), mRNA 
0   16  NM_137964.1  CG5372-RA (alphaPS5), mRNA 
0   NM_131934.1  CG3626-RA (CG3626), mRNA 
0   NM_165490.1  CG3427-RA (Epac), mRNA 
0   NM_078903.3  CG12110-RD, transcript variant D (Pld), mRNA 
0   NM_165470.2  CG12110-RB, transcript variant B (Pld), mRNA 
0   NM_165471.2  CG12110-RC, transcript variant C (Pld), mRNA 
0   NM_165469.2  CG12110-RA, transcript variant A (Pld), mRNA 
0   NM_165472.2  CG12110-RE, transcript variant E (Pld), mRNA 
0   NM_079667.2  CG7629-RA (AttD), mRNA 
0   NM_166546.2  CG30092-RD, transcript variant D (jbug), mRNA 
0   NM_170467.1  CG31025-RB, transcript variant B (CG31025), mRNA 
0   NM_164924.1  CG31716-RG, transcript variant G (CG31716), mRNA 
0   NM_164920.1  CG31716-RB, transcript variant B (CG31716), mRNA 
0   NM_164922.1  CG31716-RD, transcript variant D (CG31716), mRNA 
0   NM_164921.1  CG31716-RC, transcript variant C (CG31716), mRNA 
0   NM_164923.1  CG31716-RE, transcript variant E (CG31716), mRNA 
0   NM_164919.1  CG31716-RA, transcript variant A (CG31716), mRNA 
0   NM_170466.1  CG31025-RA, transcript variant A (CG31025), mRNA 
0   NM_166790.2  CG32019-RA, transcript variant A (bt), mRNA 
0   NM_205877.1  CG32019-RD, transcript variant D (bt), mRNA 
0   NM_142947.2  CG5933-RA (CG5933), mRNA 
0   NM_205876.1  CG32019-RC, transcript variant C (bt), mRNA 
0   NM_058100.3  CG6521-RA (Stam), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.