National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 16742R-3 
 Symbol CG16742  Full Name CG16742 
 CG No CG16742  Old CG No CG16742 
 Synonyms CG16742 
 Accession No (Link to NCBI) NM_137652.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal semi-lethal 
 Map Viewer
[Please submit your publication]
Verboon JM, Decker JR, Nakamura M, Parkhurst SM.
Wash exhibits context-dependent phenotypes and, along with the WASH regulatory complex, regulates Drosophila oogenesis.
J Cell Sci (2018) 131(8) [ PubMed ID = 29549166 ] [ RRC reference ]

Verboon JM, Nakamura M, Davidson KA, Decker JR, Nandakumar V, Parkhurst SM.
Drosophila Wash and the Wash regulatory complex function in nuclear envelope budding.
J Cell Sci (2020) 133(13) [ PubMed ID = 32503943 ] [ RRC reference ]

Yano H, Yamamoto-Hino M, Awano W, Aoki-Kinoshita KF, Tsuda-Sakurai K, Okano H, Goto S.
Identification of proteasome components required for apical localization of Chaoptin using functional genomics.
J Neurogenet (2012) 26(1) 53-63 [ PubMed ID = 22417167 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AAGTATGCCGGGTTGTATGACAGTAAGGAGAATAGTGAAGATGACAGATCCGAGGAATTC 60

                           |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| silico     61  TCCTCAAGCTCATCGGACGAAAAGGAACCCGAGACCAAAAAAATAGCAACGCCAGCGAAC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAATTAGAAGAACAGCATCTGTCTGACTCCTCTTCCCTAGCCTCGTTTGCCAGGGAACCG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCAATCGTGTCGCCAGTCATTAACCCTGCTGTTCAGGTAGCAGAGCCTGTCATCAGAACA 240

                           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| silico     241 CAACCGCGTCCAATTATAAACAGTCAAAGGAATCCACATGAGAGGGACATGTTTGCTGCC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTCCGGCAATCGCCGCCTAGCGACGACCCGCCATCCACATCGTCATCGCCTACATCTTCA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| silico     361 CCAGCCTTTAGGAATCCATCAAGTCGCCTTCCAATCGTATCTACTGCATCGC-TTAGTTC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CAGTAGCAGTAGTCCTGCCCAACAACCTCCTCGACTCTTCGACGAAGCTGTTTCAACCCA 480

16742R-3.IR_full       481 AACTCCGAAGGAGGCNTGAGAT 502
                           ||||||||||||||| |||||| silico     481 AACTCCGAAGGAGGC-TGAGAT 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137652.2  CG16742-RA, transcript variant A (CG16742), mRNA 
0   NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   NM_206564.1  CG5794-RE, transcript variant E (CG5794), mRNA 
0   NM_079858.3  CG12070-RA, transcript variant A (Sap-r), mRNA 
0   NM_170529.2  CG12070-RB, transcript variant B (Sap-r), mRNA 
0   NM_142374.2  CG5823-RA (CG5823), mRNA 
0   NM_130536.1  CG14625-RB (CG14625), mRNA 
0   NM_143637.3  CG1937-RA (sip3), mRNA 
0   NM_168210.1  CG8582-RA, transcript variant A (Sh3beta), mRNA 
0   NM_139855.2  CG8582-RB, transcript variant B (Sh3beta), mRNA 
0   NM_140709.1  CG13724-RA (CG13724), mRNA 
0   NM_078794.2  CG9564-RA (Try29F), mRNA 
0   NM_165738.1  CG2269-RC, transcript variant C (CG2269), mRNA 
0   NM_136709.2  CG2269-RA, transcript variant A (CG2269), mRNA 
0   NM_165737.1  CG2269-RB, transcript variant B (CG2269), mRNA 
0   10  NM_140223.1  CG14137-RA (CG14137), mRNA 
0   NM_079979.2  CG18497-RB, transcript variant B (spen), mRNA 
0   NM_164374.1  CG18497-RA, transcript variant A (spen), mRNA 
0   NM_164375.1  CG18497-RC, transcript variant C (spen), mRNA 
0   NM_079290.2  CG6721-RA, transcript variant A (Gap1), mRNA 
0   NM_168382.1  CG6721-RB, transcript variant B (Gap1), mRNA 
0   NM_168099.1  CG32234-RA (CG32234), mRNA 
0   NM_176460.1  CG31374-RC, transcript variant C (CG31374), mRNA 
0   NM_169390.2  CG31374-RB, transcript variant B (CG31374), mRNA 
0   NM_080258.2  CG10229-RA (katanin-60), mRNA 
0   NM_169391.1  CG31374-RA, transcript variant A (CG31374), mRNA 
0   NM_135604.2  CG12299-RA (CG12299), mRNA 
0   NM_057490.3  CG6702-RA (Cbp53E), mRNA 
0   NM_176700.1  CG3035-RA (cm), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.