National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1599R-1 
 Symbol CG1599  Full Name CG1599 
 CG No CG1599  Old CG No CG1599 
 Synonyms CG1599 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees late pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Jean S, Cox S, Nassari S, Kiger AA.
Starvation-induced MTMR13 and RAB21 activity regulates VAMP8 to promote autophagosome-lysosome fusion.
EMBO Rep. (2015) 16(3) 297-311 [ PubMed ID = 25648148 ] [ RRC reference ]

Fujita N, Huang W, Lin TH, Groulx JF, Jean S, Nguyen J, Kuchitsu Y, Koyama-Honda I, Mizushima N, Fukuda M, Kiger AA.
Genetic screen in Drosophila muscle identifies autophagy-mediated T-tubule remodeling and a Rab2 role in autophagy.
Elife (2017) 6 [ PubMed ID = 28063257 ] [ RRC reference ]

Takáts S, Nagy P, Varga Á, Pircs K, Kárpáti M, Varga K, Kovács AL, Hegedűs K, Juhász G.
Autophagosomal Syntaxin17-dependent lysosomal degradation maintains neuronal function in Drosophila.
J. Cell Biol. (2013) 201(4) 531-9 [ PubMed ID = 23671310 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACCACAGTGCTGGCGAAGTT 
 Primer Seq. 3'
aatctagaggtaccAATTTCGGGAGGCCTTACGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

1599R-1.IR full       1   CACCACAGTNCTGGCGAAGTTTGCGGAGTGCGTCG-CAACTTTGCNNA-GTGACGGAGNA 60
                          ||||||||| ||||||||||||||||||||||||| |||||||||  | ||||||||| |
1599R-1.in silico     1   CACCACAGTGCTGGCGAAGTTTGCGGAGTGCGTCGGCAACTTTGCCGAAGTGACGGAGCA 60


1599R-1.IR full       61  CATAATCGGACGGATCGGGGTGCATAACCACAAGATGACCTACACACACGGAGACTACCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1599R-1.in silico     61  CATAATCGGACGGATCGGGGTGCATAACCACAAGATGACCTACACACACGGAGACTACCT 120


1599R-1.IR full       121 GATCCACTACACCTGCGAGAACAAACTGGTCTACATGTGCATCACCGACAACGAGTTCGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1599R-1.in silico     121 GATCCACTACACCTGCGAGAACAAACTGGTCTACATGTGCATCACCGACAACGAGTTCGA 180


1599R-1.IR full       181 ACGGTCGCGGGCCTTCCTCTTCTTGGCGGATATCAAGCAGAAGTTTATCCAGACTTACGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1599R-1.in silico     181 ACGGTCGCGGGCCTTCCTCTTCTTGGCGGATATCAAGCAGAAGTTTATCCAGACTTACGG 240


1599R-1.IR full       241 CCTACAGGTGGCCACCGCCATCGCCTACTCCATGAACACCGAGTTCTCCAAGATCCTGGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1599R-1.in silico     241 CCTACAGGTGGCCACCGCCATCGCCTACTCCATGAACACCGAGTTCTCCAAGATCCTGGC 300


1599R-1.IR full       301 CCAGCAGATGGTCTATTTCAGTCAGTCCCGGGAGGTGGACACCATTTCGCGAGTACATGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1599R-1.in silico     301 CCAGCAGATGGTCTATTTCAGTCAGTCCCGGGAGGTGGACACCATTTCGCGAGTACATGG 360


1599R-1.IR full       361 TCAGATTGACGAGCTTAAAGACATTATGGTTAAGAATATTGACAGCTTGCGGGATCGCGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1599R-1.in silico     361 TCAGATTGACGAGCTTAAAGACATTATGGTTAAGAATATTGACAGCTTGCGGGATCGCGG 420


1599R-1.IR full       421 CGAGAAACTAGAGCTGCTCGTCAACAAGACCGAAAACTTGAGCAATAATTCCGTTGCATT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1599R-1.in silico     421 CGAGAAACTAGAGCTGCTCGTCAACAAGACCGAAAACTTGAGCAATAATTCCGTTGCATT 480


1599R-1.IR full       481 CCGTAAGGCCTCCCGAAATT 500
                          ||||||||||||||||||||
1599R-1.in silico     481 CCGTAAGGCCTCCCGAAATT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.