National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1599R-1 
 Symbol CG1599  Full Name CG1599 
 CG No CG1599  Old CG No CG1599 
 Synonyms CG1599 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees late pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Fujita N, Huang W, Lin TH, Groulx JF, Jean S, Nguyen J, Kuchitsu Y, Koyama-Honda I, Mizushima N, Fukuda M, Kiger AA.
Genetic screen in Drosophila muscle identifies autophagy-mediated T-tubule remodeling and a Rab2 role in autophagy.
Elife (2017) 6 [ PubMed ID = 28063257 ] [ RRC reference ]

Jean S, Cox S, Nassari S, Kiger AA.
Starvation-induced MTMR13 and RAB21 activity regulates VAMP8 to promote autophagosome-lysosome fusion.
EMBO Rep. (2015) 16(3) 297-311 [ PubMed ID = 25648148 ] [ RRC reference ]

Takáts S, Nagy P, Varga Á, Pircs K, Kárpáti M, Varga K, Kovács AL, Hegedűs K, Juhász G.
Autophagosomal Syntaxin17-dependent lysosomal degradation maintains neuronal function in Drosophila.
J Cell Biol. (2013) 201(4) 531-9 [ PubMed ID = 23671310 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACCACAGTGCTGGCGAAGTT 
 Primer Seq. 3'
aatctagaggtaccAATTTCGGGAGGCCTTACGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CACCACAGTN CTGGCGAAGT TTGCGGAGTG CGTCGCAACT TTGCNNAGTG ACGGAGNACA 
0061 TAATCGGACG GATCGGGGTG CATAACCACA AGATGACCTA CACACACGGA GACTACCTGA 
0121 TCCACTACAC CTGCGAGAAC AAACTGGTCT ACATGTGCAT CACCGACAAC GAGTTCGAAC 
0181 GGTCGCGGGC CTTCCTCTTC TTGGCGGATA TCAAGCAGAA GTTTATCCAG ACTTACGGCC 
0241 TACAGGTGGC CACCGCCATC GCCTACTCCA TGAACACCGA GTTCTCCAAG ATCCTGGCCC 
0301 AGCAGATGGT CTATTTCAGT CAGTCCCGGG AGGTGGACAC CATTTCGCGA GTACATGGTC 
0361 AGATTGACGA GCTTAAAGAC ATTATGGTTA AGAATATTGA CAGCTTGCGG GATCGCGGCG 
0421 AGAAACTAGA GCTGCTCGTC AACAAGACCG AAAACTTGAG CAATAATTCC GTTGCATTCC 
0481 GTAAGGCCTC CCGAAATT 
 in silico PCR Fragment
0001 CACCACAGTG CTGGCGAAGT TTGCGGAGTG CGTCGGCAAC TTTGCCGAAG TGACGGAGCA 
0061 CATAATCGGA CGGATCGGGG TGCATAACCA CAAGATGACC TACACACACG GAGACTACCT 
0121 GATCCACTAC ACCTGCGAGA ACAAACTGGT CTACATGTGC ATCACCGACA ACGAGTTCGA 
0181 ACGGTCGCGG GCCTTCCTCT TCTTGGCGGA TATCAAGCAG AAGTTTATCC AGACTTACGG 
0241 CCTACAGGTG GCCACCGCCA TCGCCTACTC CATGAACACC GAGTTCTCCA AGATCCTGGC 
0301 CCAGCAGATG GTCTATTTCA GTCAGTCCCG GGAGGTGGAC ACCATTTCGC GAGTACATGG 
0361 TCAGATTGAC GAGCTTAAAG ACATTATGGT TAAGAATATT GACAGCTTGC GGGATCGCGG 
0421 CGAGAAACTA GAGCTGCTCG TCAACAAGAC CGAAAACTTG AGCAATAATT CCGTTGCATT 
0481 CCGTAAGGCC TCCCGAAATT  
 Assemble Data

1599R-1.IR full       1   CACCACAGTNCTGGCGAAGTTTGCGGAGTGCGTCG-CAACTTTGCNNA-GTGACGGAGNA 60
                          ||||||||| ||||||||||||||||||||||||| |||||||||  | ||||||||| |
1599R-1.in silico     1   CACCACAGTGCTGGCGAAGTTTGCGGAGTGCGTCGGCAACTTTGCCGAAGTGACGGAGCA 60


1599R-1.IR full       61  CATAATCGGACGGATCGGGGTGCATAACCACAAGATGACCTACACACACGGAGACTACCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1599R-1.in silico     61  CATAATCGGACGGATCGGGGTGCATAACCACAAGATGACCTACACACACGGAGACTACCT 120


1599R-1.IR full       121 GATCCACTACACCTGCGAGAACAAACTGGTCTACATGTGCATCACCGACAACGAGTTCGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1599R-1.in silico     121 GATCCACTACACCTGCGAGAACAAACTGGTCTACATGTGCATCACCGACAACGAGTTCGA 180


1599R-1.IR full       181 ACGGTCGCGGGCCTTCCTCTTCTTGGCGGATATCAAGCAGAAGTTTATCCAGACTTACGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1599R-1.in silico     181 ACGGTCGCGGGCCTTCCTCTTCTTGGCGGATATCAAGCAGAAGTTTATCCAGACTTACGG 240


1599R-1.IR full       241 CCTACAGGTGGCCACCGCCATCGCCTACTCCATGAACACCGAGTTCTCCAAGATCCTGGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1599R-1.in silico     241 CCTACAGGTGGCCACCGCCATCGCCTACTCCATGAACACCGAGTTCTCCAAGATCCTGGC 300


1599R-1.IR full       301 CCAGCAGATGGTCTATTTCAGTCAGTCCCGGGAGGTGGACACCATTTCGCGAGTACATGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1599R-1.in silico     301 CCAGCAGATGGTCTATTTCAGTCAGTCCCGGGAGGTGGACACCATTTCGCGAGTACATGG 360


1599R-1.IR full       361 TCAGATTGACGAGCTTAAAGACATTATGGTTAAGAATATTGACAGCTTGCGGGATCGCGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1599R-1.in silico     361 TCAGATTGACGAGCTTAAAGACATTATGGTTAAGAATATTGACAGCTTGCGGGATCGCGG 420


1599R-1.IR full       421 CGAGAAACTAGAGCTGCTCGTCAACAAGACCGAAAACTTGAGCAATAATTCCGTTGCATT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1599R-1.in silico     421 CGAGAAACTAGAGCTGCTCGTCAACAAGACCGAAAACTTGAGCAATAATTCCGTTGCATT 480


1599R-1.IR full       481 CCGTAAGGCCTCCCGAAATT 500
                          ||||||||||||||||||||
1599R-1.in silico     481 CCGTAAGGCCTCCCGAAATT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.