National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15905R-1 
 Symbol CG15905  Full Name CG15905 
 CG No CG15905  Old CG No CG15905 
 Synonyms CG15905 
 Accession No (Link to NCBI) NM_137592.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ibrahim DM, Biehs B, Kornberg TB, Klebes A.
Microarray comparison of anterior and posterior Drosophila wing imaginal disc cells identifies novel wing genes.
G3 (Bethesda) (2013) 3(8) 1353-62 [ PubMed ID = 23749451 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGATTCAGGGCGAGTGGTTTT 
 Primer Seq. 3'
aatctagaggtaccTGTACTCAATGTTCTCGCGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GNATTCAGGG CGAGTGGTTT TCGATCAGCG ACAGACTGGC AGATTCAACA TCCACGTTAG 
0061 CATCAAGGAT GTGGCCATCA TCGAGGTGGG CCAGAATGGA CTGGCCGAGG AGACGTATAA 
0121 CGATGAGGAG GATTACTACT ATGATGACAG TGCGTTGACC GTCAAACCGA TCAAGCTAAC 
0181 TACAGGGACC AGTAGCACCA CAACAACGAG CACCACATCG GCCACCCTGC CAGAGAGCAC 
0241 TGTATCTACA GTGGCTCCTA CTACCGANAG CCACGCAGCT GAATACAAGC TTTAGCTCAA 
0301 ATCTGTTGGC TGACATTGCG GCCAGTGGTA TAACGAAGCC CAAGTCCAGG CTGAACAATC 
0361 TGATGATTGT AGAGACGCCA ATCGGCGGTC TAACGAAGCC CTTGCACCAC CCACTTCATG 
0421 CTCGATCCAA GGATATACCC AGTATGGCTG CAGCGGCACC AACTGCTTTA ATTACGCCAC 
0481 CCACTTTGCG CGAGAACATT GAGTACA 
 in silico PCR Fragment
0001 GGATTCAGGG CGAGTGGTTT TCGATCAGCG ACAGACTGGC AGATTCAACA TCCACGTTAG 
0061 CATCAAGGAT GTGGCCATCA TCGAGGTGGG CCAGAATGGA CTGGCCGAGG AGACGTATAA 
0121 CGATGAGGAG GATTACTACT ATGATGACAG TGCGTTGACC GTCAAACCGA TCAAGCTAAC 
0181 TACAGGGACC AGTAGCACCA CAACAACGAG CACCACATCG GCCACCCTGC CAGAGAGCAC 
0241 TGTATCTACA GTGGCTCCTA CTACCGA-AG CCACGCAGCT GAATACAAGC TT------AA 
0301 ATCTGTTGGC TGACATTGCG GCCAGTGGTA TAACGAAGCC CAAGTCCAGA CTAAACAATC 
0361 TGATGATTGT AGAGACGCCA ATCGGCGGTC TAACGAAGCC CTTGCACCAC CCACTTCATG 
0421 CTCGATCCAA GGATATACCC AGTATGGCTG CAGCGGCACC AACTGCTTTA ATTACGCCAC 
0481 CCACTTTGCG CGAGAACATT GAGTACA 
 Assemble Data

15905R-1.IR_full       1   GNATTCAGGGCGAGTGGTTTTCGATCAGCGACAGACTGGCAGATTCAACATCCACGTTAG 60
                           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15905R-1.in silico     1   GGATTCAGGGCGAGTGGTTTTCGATCAGCGACAGACTGGCAGATTCAACATCCACGTTAG 60


15905R-1.IR_full       61  CATCAAGGATGTGGCCATCATCGAGGTGGGCCAGAATGGACTGGCCGAGGAGACGTATAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15905R-1.in silico     61  CATCAAGGATGTGGCCATCATCGAGGTGGGCCAGAATGGACTGGCCGAGGAGACGTATAA 120


15905R-1.IR_full       121 CGATGAGGAGGATTACTACTATGATGACAGTGCGTTGACCGTCAAACCGATCAAGCTAAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15905R-1.in silico     121 CGATGAGGAGGATTACTACTATGATGACAGTGCGTTGACCGTCAAACCGATCAAGCTAAC 180


15905R-1.IR_full       181 TACAGGGACCAGTAGCACCACAACAACGAGCACCACATCGGCCACCCTGCCAGAGAGCAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15905R-1.in silico     181 TACAGGGACCAGTAGCACCACAACAACGAGCACCACATCGGCCACCCTGCCAGAGAGCAC 240


15905R-1.IR_full       241 TGTATCTACAGTGGCTCCTACTACCGANAGCCACGCAGCTGAATACAAGCTTTAGCTCAA 300
                           ||||||||||||||||||||||||||| ||||||||||||||||||||||||      ||
15905R-1.in silico     241 TGTATCTACAGTGGCTCCTACTACCGA-AGCCACGCAGCTGAATACAAGCTT------AA 300


15905R-1.IR_full       301 ATCTGTTGGCTGACATTGCGGCCAGTGGTATAACGAAGCCCAAGTCCAGGCTGAACAATC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||
15905R-1.in silico     301 ATCTGTTGGCTGACATTGCGGCCAGTGGTATAACGAAGCCCAAGTCCAGACTAAACAATC 360


15905R-1.IR_full       361 TGATGATTGTAGAGACGCCAATCGGCGGTCTAACGAAGCCCTTGCACCACCCACTTCATG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15905R-1.in silico     361 TGATGATTGTAGAGACGCCAATCGGCGGTCTAACGAAGCCCTTGCACCACCCACTTCATG 420


15905R-1.IR_full       421 CTCGATCCAAGGATATACCCAGTATGGCTGCAGCGGCACCAACTGCTTTAATTACGCCAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15905R-1.in silico     421 CTCGATCCAAGGATATACCCAGTATGGCTGCAGCGGCACCAACTGCTTTAATTACGCCAC 480


15905R-1.IR_full       481 CCACTTTGCGCGAGAACATTGAGTACA 507
                           |||||||||||||||||||||||||||
15905R-1.in silico     481 CCACTTTGCGCGAGAACATTGAGTACA 507

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137592.1  CG15905-RA (CG15905), mRNA 
0   NM_136265.2  CG17571-RA (CG17571), mRNA 
0   12  42  NM_170227.2  CG31439-RA (CG31439), mRNA 
0   NM_079195.2  CG15002-RB (mas), mRNA 
0   NM_001032244.1  CG32904-RA, transcript variant A (seq), mRNA 
0   12  NM_079204.1  CG7525-RA (Tie), mRNA 
0   NM_142585.1  CG4733-RA (CG4733), mRNA 
0   NM_140191.1  CG6207-RA, transcript variant A (GlcAT-P), mRNA 
0   NM_079444.2  CG8727-RA (cyc), mRNA 
0   NM_136877.3  CG8357-RA (Rep1), mRNA 
0   NM_132121.2  CG3135-RA (shf), mRNA 
0   NM_166940.1  CG32796-RB, transcript variant B (CG32796), mRNA 
0   NM_167881.1  CG12085-RC, transcript variant C (pUf68), mRNA 
0   NM_167882.1  CG12085-RD, transcript variant D (pUf68), mRNA 
0   NM_080384.2  CG12085-RA, transcript variant A (pUf68), mRNA 
0   NM_167880.1  CG12085-RB, transcript variant B (pUf68), mRNA 
0   12  NM_136854.1  CG13194-RA (pyr), mRNA 
0   NM_141542.1  CG11718-RA (CG11718), mRNA 
0   NM_057786.3  CG7434-RA (RpL22), mRNA 
0   NM_132211.1  CG2258-RA, transcript variant A (CG2258), mRNA 
0   NM_166603.1  CG3530-RA, transcript variant A (CG3530), mRNA 
0   NM_137947.2  CG3530-RB, transcript variant B (CG3530), mRNA 
0   NM_143348.2  CG4849-RA (CG4849), mRNA 
0   NM_079541.2  CG1089-RA (alpha-Est5), mRNA 
0   NM_167986.1  CG7740-RA, transcript variant A (prominin-like), mRNA 
0   NM_057516.3  CG5403-RA, transcript variant A (retn), mRNA 
0   NM_176254.1  CG5403-RB, transcript variant B (retn), mRNA 
0   NM_136834.1  CG13204-RA, transcript variant A (CG13204), mRNA 
0   NM_165657.1  CG8046-RA, transcript variant A (CG8046), mRNA 
0   NM_136621.2  CG8046-RB, transcript variant B (CG8046), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.