National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15651R-2 
 Symbol CG15651  Full Name CG15651 
 CG No CG15651  Old CG No CG15651 
 Synonyms CG15651 
 Accession No (Link to NCBI) NM_137687.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTCGGATTTCTGCTGGCCAA 
 Primer Seq. 3'
aatctagaggtaccCGCGCAGAATCTTCTGCAGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCTCGGATTT CTGCTGGCCA ATCTGGTGTT TCTCTATTAC ACGTGGAACA CGCTGCTCTG 
0061 GCGGCGGATA AGTAGGGCTC TGTCCGGTGA ATCTCAGCCG GCAGAGGAAC CGCCAAAGGC 
0121 CGCCAAGCTG TCGCCCAAGG AGAAGCTGCG CAATGCCAAC AAACACATAC GCAAGTCCAT 
0181 CACCATTGTG TTCTATGGCC ACTACAACTT TGAGCAGGAT CTGAAGGCAT CGATCGACAG 
0241 CATCCTGGAC GTGATACCCA ACATGCCCAT CCTGGTGCTT CAGGATGNCG GTGCCGAGTA 
0301 CGCCTATCCG CCGGTCAACT ACGAACGGAA CCTAACCGCC GGCGAGGAGC GCACCGTGCT 
0361 ATTCCAGGGT CTGTCCTTCG ATGTGCGGCG AACGCGGCAG GAGCTGAATC CCTTGGCGTC 
0421 CATTCGGACC AAGTACGCTC TCATCATGCC GGATGGCGTG CGGCTGAACA GCAAGAACAT 
0481 CCTGCAGAAG ATTCTGCGCG  
 in silico PCR Fragment
0001 GCTCGGATTT CTGCTGGCCA ATCTGGTGTT TCTCTATTAC ACGTGGAACA CGCTGCTCTG 
0061 GCGGCGGATA AGTAGGGCTC TGTCCGGTGA ATCTCAGCCG GCAGAGGAAC CGCCAAAGGC 
0121 CGCCAAGCTG TCGCCCAAGG AGAAGCTGCG CAATGCCAAC AAACACATAC GCAAGTCCAT 
0181 CACCATCGTG TTCTATGGCC ACTACAACTT TGAGCAGGAT CTGAAGGCAT CGATCGACAG 
0241 CATCCTGGAC GTGATACCCA ACATGCCCAT CCTGGTGCTT CAGGATGGCG GTGCCGAGTA 
0301 CGCCTATCCG CCGGTCAACT ACGAACGGAA CCTAACCGCC GGCGAGGAGC GCACCGTGCT 
0361 ATTCCAGAGT CTGTCCTTCG ATGTGCGGCG AACGCGGCAG GAGCTGAATC CCTTGGCGTC 
0421 CATTCGGACC AAATACGCTC TCATCATGCC GGACGGCGTG CGGCTGAACA GCAAGAACAT 
0481 CCTGCAGAAG ATTCTGCGCG  
 Assemble Data

15651R-2.IR_full       1   GCTCGGATTTCTGCTGGCCAATCTGGTGTTTCTCTATTACACGTGGAACACGCTGCTCTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15651R-2.in silico     1   GCTCGGATTTCTGCTGGCCAATCTGGTGTTTCTCTATTACACGTGGAACACGCTGCTCTG 60


15651R-2.IR_full       61  GCGGCGGATAAGTAGGGCTCTGTCCGGTGAATCTCAGCCGGCAGAGGAACCGCCAAAGGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15651R-2.in silico     61  GCGGCGGATAAGTAGGGCTCTGTCCGGTGAATCTCAGCCGGCAGAGGAACCGCCAAAGGC 120


15651R-2.IR_full       121 CGCCAAGCTGTCGCCCAAGGAGAAGCTGCGCAATGCCAACAAACACATACGCAAGTCCAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15651R-2.in silico     121 CGCCAAGCTGTCGCCCAAGGAGAAGCTGCGCAATGCCAACAAACACATACGCAAGTCCAT 180


15651R-2.IR_full       181 CACCATTGTGTTCTATGGCCACTACAACTTTGAGCAGGATCTGAAGGCATCGATCGACAG 240
                           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
15651R-2.in silico     181 CACCATCGTGTTCTATGGCCACTACAACTTTGAGCAGGATCTGAAGGCATCGATCGACAG 240


15651R-2.IR_full       241 CATCCTGGACGTGATACCCAACATGCCCATCCTGGTGCTTCAGGATGNCGGTGCCGAGTA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
15651R-2.in silico     241 CATCCTGGACGTGATACCCAACATGCCCATCCTGGTGCTTCAGGATGGCGGTGCCGAGTA 300


15651R-2.IR_full       301 CGCCTATCCGCCGGTCAACTACGAACGGAACCTAACCGCCGGCGAGGAGCGCACCGTGCT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15651R-2.in silico     301 CGCCTATCCGCCGGTCAACTACGAACGGAACCTAACCGCCGGCGAGGAGCGCACCGTGCT 360


15651R-2.IR_full       361 ATTCCAGGGTCTGTCCTTCGATGTGCGGCGAACGCGGCAGGAGCTGAATCCCTTGGCGTC 420
                           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
15651R-2.in silico     361 ATTCCAGAGTCTGTCCTTCGATGTGCGGCGAACGCGGCAGGAGCTGAATCCCTTGGCGTC 420


15651R-2.IR_full       421 CATTCGGACCAAGTACGCTCTCATCATGCCGGATGGCGTGCGGCTGAACAGCAAGAACAT 480
                           |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||
15651R-2.in silico     421 CATTCGGACCAAATACGCTCTCATCATGCCGGACGGCGTGCGGCTGAACAGCAAGAACAT 480


15651R-2.IR_full       481 CCTGCAGAAGATTCTGCGCG 500
                           ||||||||||||||||||||
15651R-2.in silico     481 CCTGCAGAAGATTCTGCGCG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137687.2  CG15651-RA (CG15651), mRNA 
0   NM_001031910.1  CG11566-RA (CG11566), mRNA 
0   NM_001031911.1  CG33670-RA (CG33670), mRNA 
0   NM_131970.1  CG6903-RA (CG6903), mRNA 
0   NM_079914.2  CG9936-RD, transcript variant D (skd), mRNA 
0   NM_168879.2  CG9936-RC, transcript variant C (skd), mRNA 
0   NM_165345.1  CG9331-RA, transcript variant A (CG9331), mRNA 
0   NM_176067.1  CG9331-RD, transcript variant D (CG9331), mRNA 
0   NM_176066.2  CG9331-RC, transcript variant C (CG9331), mRNA 
0   NM_206015.1  CG9331-RE, transcript variant E (CG9331), mRNA 
0   NM_136218.2  CG9331-RB, transcript variant B (CG9331), mRNA 
0   NM_139599.1  CG14990-RA (CG14990), mRNA 
0   NM_141113.2  CG7442-RA (CG7442), mRNA 
0   NM_136410.3  CG30159-RA, transcript variant A (CG30159), mRNA 
0   NM_206046.1  CG30159-RB, transcript variant B (CG30159), mRNA 
0   NM_141383.1  CG15189-RA (Osi19), mRNA 
0   NM_001043256.1  CG34157-RB, transcript variant B (Dys), mRNA 
0   16  NM_166015.1  CG18076-RG, transcript variant G (shot), mRNA 
0   16  NM_166016.1  CG18076-RB, transcript variant B (shot), mRNA 
0   16  NM_079009.2  CG18076-RA, transcript variant A (shot), mRNA 
0   16  NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   14  NM_166017.1  CG18076-RE, transcript variant E (shot), mRNA 
0   14  NM_166018.1  CG18076-RC, transcript variant C (shot), mRNA 
0   NM_166417.1  CG30291-RA (CG30291), mRNA 
0   NM_058128.3  CG11993-RA (Mst85C), mRNA 
0   NM_135380.3  CG13394-RA, transcript variant A (CG13394), mRNA 
0   NM_205937.1  CG13394-RB, transcript variant B (CG13394), mRNA 
0   NM_166183.1  CG8332-RB, transcript variant B (RpS15), mRNA 
0   NM_137292.2  CG8332-RA, transcript variant A (RpS15), mRNA 
0   NM_080113.2  CG3000-RA, transcript variant A (rap), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
VM
VB
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.