National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15651R-1 
 Symbol CG15651  Full Name CG15651 
 CG No CG15651  Old CG No CG15651 
 Synonyms CG15651 
 Accession No (Link to NCBI) NM_137687.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCTCGGATTTCTGCTGGCCAATCTGGTGTTTCTCTATTACACGTGGAACACGCTGCTCTG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCGGCGGATAAGTAGGGCTCTGTCCGGTGAATCTCAGCCGGCAGAGGAACCGCCAAAGGC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGCCAAGCTGTCGCCCAAGGAGAAGCTGCGCAATGCCAACAAACACATACGCAAGTCCAT 180

                           |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CACCATCGTGTTCTATGGCCACTACAACTTTGAGCAGGATCTGAAGGCATCGATCGACAG 240

                           ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| silico     241 CATCCTGGACGTGATACCCAACATGCCCATCCTGGTGCTTCAGGATGGCGGTGCCGAGTA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGCCTATCCGCCGGTCAACTACGAACGGAACCTAACCGCCGGCGAGGAGCGCACCGTGCT 360

                           ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ATTCCAGAGTCTGTCCTTCGATGTGCGGCGAACGCGGCAGGAGCTGAATCCCTTGGCGTC 420

                           |||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| silico     421 CATTCGGACCAAATACGCTCTCATCATGCCGGACGGCGTGCGGCTGAACAGCAAGAACAT 480

15651R-1.IR_full       481 CCTGCAGAAGATTCTGCGCG 500
                           |||||||||||||||||||| silico     481 CCTGCAGAAGATTCTGCGCG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137687.2  CG15651-RA (CG15651), mRNA 
0   NM_001031910.1  CG11566-RA (CG11566), mRNA 
0   NM_001031911.1  CG33670-RA (CG33670), mRNA 
0   NM_131970.1  CG6903-RA (CG6903), mRNA 
0   NM_079914.2  CG9936-RD, transcript variant D (skd), mRNA 
0   NM_168879.2  CG9936-RC, transcript variant C (skd), mRNA 
0   NM_165345.1  CG9331-RA, transcript variant A (CG9331), mRNA 
0   NM_176067.1  CG9331-RD, transcript variant D (CG9331), mRNA 
0   NM_176066.2  CG9331-RC, transcript variant C (CG9331), mRNA 
0   NM_206015.1  CG9331-RE, transcript variant E (CG9331), mRNA 
0   NM_136218.2  CG9331-RB, transcript variant B (CG9331), mRNA 
0   NM_139599.1  CG14990-RA (CG14990), mRNA 
0   NM_141113.2  CG7442-RA (CG7442), mRNA 
0   NM_136410.3  CG30159-RA, transcript variant A (CG30159), mRNA 
0   NM_206046.1  CG30159-RB, transcript variant B (CG30159), mRNA 
0   NM_141383.1  CG15189-RA (Osi19), mRNA 
0   NM_001043256.1  CG34157-RB, transcript variant B (Dys), mRNA 
0   16  NM_166015.1  CG18076-RG, transcript variant G (shot), mRNA 
0   16  NM_166016.1  CG18076-RB, transcript variant B (shot), mRNA 
0   16  NM_079009.2  CG18076-RA, transcript variant A (shot), mRNA 
0   16  NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   14  NM_166017.1  CG18076-RE, transcript variant E (shot), mRNA 
0   14  NM_166018.1  CG18076-RC, transcript variant C (shot), mRNA 
0   NM_166417.1  CG30291-RA (CG30291), mRNA 
0   NM_058128.3  CG11993-RA (Mst85C), mRNA 
0   NM_135380.3  CG13394-RA, transcript variant A (CG13394), mRNA 
0   NM_205937.1  CG13394-RB, transcript variant B (CG13394), mRNA 
0   NM_166183.1  CG8332-RB, transcript variant B (RpS15), mRNA 
0   NM_137292.2  CG8332-RA, transcript variant A (RpS15), mRNA 
0   NM_080113.2  CG3000-RA, transcript variant A (rap), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.