National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15610R-3 
 Symbol CG34415  Full Name
 CG No CG34415  Old CG No CG15610 
 Synonyms FBgn0085444, CG33455, CG15610, CG33456, CG34415 
 Accession No (Link to NCBI) NM_206142.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGAAGACCGCGAAAGCGCAAA 
 Primer Seq. 3'
aatctagaggtaccGTGCAGGGATTGGAGTCGAAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGAAGACCGC GAAagNNCNA ACGAGTGGAT CGCCAGAGCC TGGACTCGCA GGTCGATGAG 
0061 GATGCCAAGG AGATCGATCG CCGGCTAcgG AAAGTGGCCA AGAAGAACTC CATCAGTGCC 
0121 GAGGACATGC AAAAGGTGGT CCGGAAGGTG GTGCGCAACG ATCATGTTCT GGCATTAGTC 
0181 ACTTTGAAGG CGGAGGACGA GCTGGCGCGT GAGAAGTTGG AGTCGGCGGA GCAGCAAAAG 
0241 CGGGGTGCCA TCATCATAAC AGACACTGCC ATCTGTGCCC AAGCTAACGC GAGCGAAAGC 
0301 ACGGGAACTG AACTGCACGC CTGGGATCTC GCTGCCCCAG CTCAATGAAA CTTCCACCGA 
0361 CAATAATGGT ATAGAGGCTC TAATACGTGA GGATTTGCAC TCTGATGAGG AGGACGAGGA 
0421 GTATACCTTC AAGGAGGAGG ACTTTCATTC CGATGATGAT CCTAACACTA CAGCATCGGA 
0481 TTTCGACTCC AATCCCTGCA C 
 in silico PCR Fragment
0001 CGAAGACCGC GAAAGCGCAA ACGAGTGGAT CGCCAGAGCC TGGACTCGCA GGTCGATGAG 
0061 GATGCCAAGG AGATCGATCG CCGGCTACGG AAAGTGGCCA AGAAGAACTC CATCAGTGCC 
0121 GAGGACATGC AAAAGGTGGT CCGGAAGGTG GTGCGCAACG ATCATGTTCT GGCATTAGTC 
0181 ACTTTGAAGG CGGAGGACGA GCTGGCGCGG GAGAAGTTGG AGTCGGCGGA GCAGCAAAAG 
0241 CGGGGTGCCA TCATCATAAC GGACACT-CC ATCTGTGCCC AAGCTAACGC GAGCGAAAGC 
0301 ACGGGAACTG AACTGCACGC CTGGGATCTC GCTGCCCCAG CTCAATGAAA CTTCCACCGA 
0361 CAATAATGGT ATAGAGGCTC TAATACGTGA GGATTTGCAC TCTGATGAGG AGGACGAGGA 
0421 GTATACCTTC AAGGAGGAGG ACTTTCATTC CGATGATGAT CCTAACACTA CAGCATCGGA 
0481 TTTCGACTCC AATCCCTGCA C 
 Assemble Data

15610R-3.IR_full       1   CGAAGACCGCGAAAGNNCNAACGAGTGGATCGCCAGAGCCTGGACTCGCAGGTCGATGAG 60
                           |||||||||||||||  | |||||||||||||||||||||||||||||||||||||||||
15610R-3.in silico     1   CGAAGACCGCGAAAGCGCAAACGAGTGGATCGCCAGAGCCTGGACTCGCAGGTCGATGAG 60


15610R-3.IR_full       61  GATGCCAAGGAGATCGATCGCCGGCTACGGAAAGTGGCCAAGAAGAACTCCATCAGTGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15610R-3.in silico     61  GATGCCAAGGAGATCGATCGCCGGCTACGGAAAGTGGCCAAGAAGAACTCCATCAGTGCC 120


15610R-3.IR_full       121 GAGGACATGCAAAAGGTGGTCCGGAAGGTGGTGCGCAACGATCATGTTCTGGCATTAGTC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15610R-3.in silico     121 GAGGACATGCAAAAGGTGGTCCGGAAGGTGGTGCGCAACGATCATGTTCTGGCATTAGTC 180


15610R-3.IR_full       181 ACTTTGAAGGCGGAGGACGAGCTGGCGCGTGAGAAGTTGGAGTCGGCGGAGCAGCAAAAG 240
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
15610R-3.in silico     181 ACTTTGAAGGCGGAGGACGAGCTGGCGCGGGAGAAGTTGGAGTCGGCGGAGCAGCAAAAG 240


15610R-3.IR_full       241 CGGGGTGCCATCATCATAACAGACACTGCCATCTGTGCCCAAGCTAACGCGAGCGAAAGC 300
                           |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||
15610R-3.in silico     241 CGGGGTGCCATCATCATAACGGACACT-CCATCTGTGCCCAAGCTAACGCGAGCGAAAGC 300


15610R-3.IR_full       301 ACGGGAACTGAACTGCACGCCTGGGATCTCGCTGCCCCAGCTCAATGAAACTTCCACCGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15610R-3.in silico     301 ACGGGAACTGAACTGCACGCCTGGGATCTCGCTGCCCCAGCTCAATGAAACTTCCACCGA 360


15610R-3.IR_full       361 CAATAATGGTATAGAGGCTCTAATACGTGAGGATTTGCACTCTGATGAGGAGGACGAGGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15610R-3.in silico     361 CAATAATGGTATAGAGGCTCTAATACGTGAGGATTTGCACTCTGATGAGGAGGACGAGGA 420


15610R-3.IR_full       421 GTATACCTTCAAGGAGGAGGACTTTCATTCCGATGATGATCCTAACACTACAGCATCGGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15610R-3.in silico     421 GTATACCTTCAAGGAGGAGGACTTTCATTCCGATGATGATCCTAACACTACAGCATCGGA 480


15610R-3.IR_full       481 TTTCGACTCCAATCCCTGCAC 501
                           |||||||||||||||||||||
15610R-3.in silico     481 TTTCGACTCCAATCCCTGCAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_206142.1  CG33455-RA (CG33455), mRNA 
0.2   11  NM_079001.2  CG3886-RA (Psc), mRNA 
0   NM_058088.3  CG8730-RA (drosha), mRNA 
0   NM_176737.1  CG9213-RA (CG9213), mRNA 
0   NM_135694.2  CG6785-RA (CG6785), mRNA 
0   NM_143014.2  CG13624-RC, transcript variant C (CG13624), mRNA 
0   NM_001043288.1  CG13624-RF, transcript variant F (CG13624), mRNA 
0   NM_170150.1  CG13624-RA, transcript variant A (CG13624), mRNA 
0   NM_001043287.1  CG13624-RE, transcript variant E (CG13624), mRNA 
0   NM_170151.1  CG13624-RB, transcript variant B (CG13624), mRNA 
0   NM_170152.1  CG13624-RD, transcript variant D (CG13624), mRNA 
0   11  NM_079640.2  CG6226-RA (FK506-bp1), mRNA 
0   11  NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
0   NM_140233.1  CG7339-RA (CG7339), mRNA 
0   NM_080498.2  CG5942-RA, transcript variant A (brm), mRNA 
0   NM_079648.2  CG5083-RA (Rbf2), mRNA 
0   NM_168640.1  CG5942-RD, transcript variant D (brm), mRNA 
0   NM_168641.1  CG5942-RB, transcript variant B (brm), mRNA 
0   NM_080497.4  CG5942-RC, transcript variant C (brm), mRNA 
0   NM_132954.1  CG13000-RA (CG13000), mRNA 
0   NM_001031967.1  CG7749-RB, transcript variant B (fat2), mRNA 
0   NM_140914.2  CG7749-RA, transcript variant A (fat2), mRNA 
0   11  32  NM_001014738.1  CG7107-RF, transcript variant F (up), mRNA 
0   11  27  NM_001014737.1  CG7107-RG, transcript variant G (up), mRNA 
0   11  27  NM_167376.1  CG7107-RD, transcript variant D (up), mRNA 
0   11  27  NM_001014739.1  CG7107-RE, transcript variant E (up), mRNA 
0   11  27  NM_080349.2  CG7107-RA, transcript variant A (up), mRNA 
0   11  27  NM_167375.1  CG7107-RB, transcript variant B (up), mRNA 
0   NM_135393.2  CG13097-RA (CG13097), mRNA 
0   14  NM_142975.2  CG5669-RA (CG5669), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.