National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1560R-2 
 Symbol mys  Full Name myospheroid 
 CG No CG1560  Old CG No CG1560 
 Synonyms betaPS1, PS, betaPS, Mys, l(1)7Db, integrin beta[[PS]], CG1560, betamys, beta[[PS]]-integrin, MAb6G11, CT40473, olfC, BetaPS, b[[PS]], beta[[PS]], beta-PS, bPS, l(1)968, beta[[P]]S, l(1)mys, PSbeta, nj42, l(1)93p, EM28, l(1)G0233, l(1)G0281, l(1)EM28, l(1)DA551, l(1)7Dn, PS[[beta]], mys, beta[[mys]], betaPS Int 
 Accession No (Link to NCBI) NM_080054.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Meghana C, Ramdas N, Hameed FM, Rao M, Shivashankar GV, Narasimha M.
Integrin adhesion drives the emergent polarization of active cytoskeletal stresses to pattern cell delamination.
Proc Natl Acad Sci U S A (2011) 108(22) 9107-12 [ PubMed ID = 21571643 ] [ RRC reference ]

Eusebio N, Tavares L, Pereira PS.
CtBP represses Dpp-dependent Mad activation during Drosophila eye development.
Dev Biol (2018) 442(1) 188-198 [ PubMed ID = 30031756 ] [ RRC reference ]

Wang Y, Antunes M, Anderson AE, Kadrmas JL, Jacinto A, Galko MJ.
Integrin Adhesions Suppress Syncytium Formation in the Drosophila Larval Epidermis.
Curr Biol (2015) 25(17) 2215-27 [ PubMed ID = 26255846 ] [ RRC reference ]

Perkins AD, Ellis SJ, Asghari P, Shamsian A, Moore ED, Tanentzapf G.
Integrin-mediated adhesion maintains sarcomeric integrity.
Dev Biol (2010) 338(1) 15-27 [ PubMed ID = 19879257 ] [ RRC reference ]

Xie X, Auld VJ.
Integrins are necessary for the development and maintenance of the glial layers in the Drosophila peripheral nerve.
Development (2011) 138(17) 3813-22 [ PubMed ID = 21828098 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGATCCTCGAGAGAAACCGGAGGTGCCAGCTGGCCCTCCTCATGATCGCAATACTGGCC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| || silico     61  GCCATCGCTGGACAAACGGATGCCCAGAAGGCGGCCAAACTGACGGCAGT-GAGCACATG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGCATCGAAGGAAAAGTGTCACACCTGCATCCAGACAGAGGGTTGCGCCTGGTGCATGCA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCCGGACTTTAAGGGCCAGTCGCGGTGCTACCAAAACACCAGCTCACTGTGTCCGGAGGA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GTTCGCCTACAGTCCGATAACAGTTGAGCAGATTCTAGTGAACAACAAACTAACGAATCA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATACAAAGCTGAACTGGCGGCTGGTGGCGGCGGCTCCGCCATGTCCGGCAGCAGCTCAAG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTCCTACTCGTCGAGTTCGAGCTCGTCGAGCTTCTACTCGCAGAGCTCCTCGGGATCCAG 420

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TTCCGCCAGCGGATACGAAGAGTACTCTGCCGGCGAAATTGTCCAAATCCAACCGCAGT- 480

                          |||||||| |||||||||       | silico     481 CCATGCGA-CTCGCATTG-------C 506

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   478  NM_080054.2  CG1560-RA (mys), mRNA 
0.62   NM_135281.1  CG6630-RA (CG6630), mRNA 
0   NM_164749.1  CG5261-RA, transcript variant A (CG5261), mRNA 
0   NM_135274.2  CG5261-RB, transcript variant B (CG5261), mRNA 
0   NM_176480.1  CG33098-RB, transcript variant B (CG33098), mRNA 
0   NM_176481.1  CG33098-RC, transcript variant C (CG33098), mRNA 
0   NM_132655.1  CG1662-RA (CG1662), mRNA 
0   NM_166450.1  CG10497-RC, transcript variant C (Sdc), mRNA 
0   NM_166449.2  CG10497-RB, transcript variant B (Sdc), mRNA 
0   NM_057617.3  CG10497-RA, transcript variant A (Sdc), mRNA 
0   NM_176482.1  CG33098-RD, transcript variant D (CG33098), mRNA 
0   NM_142769.2  CG5383-RA (PSR), mRNA 
0   NM_168477.1  CG32092-RB (CG32092), mRNA 
0   NM_136733.2  CG12907-RA (CG12907), mRNA 
0   NM_206240.1  CG33484-RA, transcript variant A (zormin), mRNA 
0   NM_001043112.1  CG33484-RB, transcript variant B (zormin), mRNA 
0   NM_001043114.1  CG33484-RD, transcript variant D (zormin), mRNA 
0   NM_001043113.1  CG33484-RC, transcript variant C (zormin), mRNA 
0   NM_168802.1  CG32210-RA (CG32210), mRNA 
0   NM_057543.3  CG9998-RA (U2af50), mRNA 
0   NM_001014584.1  CG4879-RC, transcript variant C (RecQ5), mRNA 
0   NM_079346.2  CG4879-RA, transcript variant A (RecQ5), mRNA 
0   NM_139528.2  CG17569-RB, transcript variant B (gry), mRNA 
0   NM_168000.1  CG17569-RA, transcript variant A (gry), mRNA 
0   NM_143316.2  CG5586-RB (Tusp), mRNA 
0   NM_140050.2  CG4022-RA (CG4022), mRNA 
0   NM_143303.1  CG6599-RA (CG6599), mRNA 
0   NM_167469.2  CG10545-RB, transcript variant B (Gbeta13F), mRNA 
0   NM_080351.5  CG10545-RA, transcript variant A (Gbeta13F), mRNA 
0   NM_206737.1  CG10545-RE, transcript variant E (Gbeta13F), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.