National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1560R-1 
 Symbol mys  Full Name myospheroid 
 CG No CG1560  Old CG No CG1560 
 Synonyms betaPS1, PS, betaPS, Mys, l(1)7Db, integrin beta[[PS]], CG1560, betamys, beta[[PS]]-integrin, MAb6G11, CT40473, olfC, BetaPS, b[[PS]], beta[[PS]], beta-PS, bPS, l(1)968, beta[[P]]S, l(1)mys, PSbeta, nj42, l(1)93p, EM28, l(1)G0233, l(1)G0281, l(1)EM28, l(1)DA551, l(1)7Dn, PS[[beta]], mys, beta[[mys]], betaPS Int 
 Accession No (Link to NCBI) NM_080054.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Dai J, Ma M, Feng Z, Pastor-Pareja JC.
Inter-adipocyte Adhesion and Signaling by Collagen IV Intercellular Concentrations in Drosophila.
Curr. Biol. (2017) 27(18) 2729-2740.e4 [ PubMed ID = 28867208 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Kim MJ, Choe KM.
Basement membrane and cell integrity of self-tissues in maintaining Drosophila immunological tolerance.
PLoS Genet. (2014) 10(10) e1004683 [ PubMed ID = 25329560 ] [ RRC reference ]

Xie X, Gilbert M, Petley-Ragan L, Auld VJ.
Loss of focal adhesions in glia disrupts both glial and photoreceptor axon migration in the Drosophila visual system.
Development (2014) 141(15) 3072-83 [ PubMed ID = 25053436 ] [ RRC reference ]

Meghana C, Ramdas N, Hameed FM, Rao M, Shivashankar GV, Narasimha M.
Integrin adhesion drives the emergent polarization of active cytoskeletal stresses to pattern cell delamination.
Proc. Natl. Acad. Sci. U.S.A. (2011) 108(22) 9107-12 [ PubMed ID = 21571643 ] [ RRC reference ]

Perkins AD, Ellis SJ, Asghari P, Shamsian A, Moore ED, Tanentzapf G.
Integrin-mediated adhesion maintains sarcomeric integrity.
Dev. Biol. (2009) 338(1) 15-27 [ PubMed ID = 19879257 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGATCCTCGAGAGAAACCGG 
 Primer Seq. 3'
aatctagaggtaccGCAATGCGAGTCGCATGGACT 
 Predicted Fragment Size
496 
 IR fragment full Seq
0001 ATGATCCTCG AGAGAAACCG GAGgtGCCAG CTGGcCCTCC TCATGATCGC AATACTGGCC 
0061 GCCATCGCTG GACAAACGGA TGCCCAGAAG GCGGCCAAAC TGACGGCAGT NGAGCACCTG 
0121 TGCATCGAAG GAAAAGTGTC ACACCTGCAT CCAGACAGAG GGTTGCGCCT GGTGCATGCA 
0181 GCCGGACTTT AAGGGCCAGT CGCGGTGCTA CCAAAACACC AGCTCACTGT GTCCGGAGGA 
0241 GTTCGCCTAC AGTCCGATAA CAGTTGAGCA GATTCTAGTG AACAACAAAC TAACGAATCA 
0301 ATACAAAGCT GAACTGGCGG CTGGTGGCGG CGGCTCcGCC ATGTCCGGCA GCAGCTCAAG 
0361 CTCCTACTCG TCGAGTTCGA GCTCGTCGAG CTTCTACTCG CAGAGCTCCT CGGGATCCAG 
0421 TTCCGCCAGC GGATACGAAG AGTACTCTGC CGGCGAAATT GTCCAAATCC AACCGCAGTN 
0481 CCATGCGANC TCGCATTGGG NACCTC 
 in silico PCR Fragment
0001 ATGATCCTCG AGAGAAACCG GAGGTGCCAG CTGGCCCTCC TCATGATCGC AATACTGGCC 
0061 GCCATCGCTG GACAAACGGA TGCCCAGAAG GCGGCCAAAC TGACGGCAGT -GAGCACATG 
0121 TGCATCGAAG GAAAAGTGTC ACACCTGCAT CCAGACAGAG GGTTGCGCCT GGTGCATGCA 
0181 GCCGGACTTT AAGGGCCAGT CGCGGTGCTA CCAAAACACC AGCTCACTGT GTCCGGAGGA 
0241 GTTCGCCTAC AGTCCGATAA CAGTTGAGCA GATTCTAGTG AACAACAAAC TAACGAATCA 
0301 ATACAAAGCT GAACTGGCGG CTGGTGGCGG CGGCTCCGCC ATGTCCGGCA GCAGCTCAAG 
0361 CTCCTACTCG TCGAGTTCGA GCTCGTCGAG CTTCTACTCG CAGAGCTCCT CGGGATCCAG 
0421 TTCCGCCAGC GGATACGAAG AGTACTCTGC CGGCGAAATT GTCCAAATCC AACCGCAGT- 
0481 CCATGCGA-C TCGCATTG-- -----C 
 Assemble Data

1560R-1.IR_full       1   ATGATCCTCGAGAGAAACCGGAGGTGCCAGCTGGCCCTCCTCATGATCGCAATACTGGCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1560R-1.in silico     1   ATGATCCTCGAGAGAAACCGGAGGTGCCAGCTGGCCCTCCTCATGATCGCAATACTGGCC 60


1560R-1.IR_full       61  GCCATCGCTGGACAAACGGATGCCCAGAAGGCGGCCAAACTGACGGCAGTNGAGCACCTG 120
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||
1560R-1.in silico     61  GCCATCGCTGGACAAACGGATGCCCAGAAGGCGGCCAAACTGACGGCAGT-GAGCACATG 120


1560R-1.IR_full       121 TGCATCGAAGGAAAAGTGTCACACCTGCATCCAGACAGAGGGTTGCGCCTGGTGCATGCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1560R-1.in silico     121 TGCATCGAAGGAAAAGTGTCACACCTGCATCCAGACAGAGGGTTGCGCCTGGTGCATGCA 180


1560R-1.IR_full       181 GCCGGACTTTAAGGGCCAGTCGCGGTGCTACCAAAACACCAGCTCACTGTGTCCGGAGGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1560R-1.in silico     181 GCCGGACTTTAAGGGCCAGTCGCGGTGCTACCAAAACACCAGCTCACTGTGTCCGGAGGA 240


1560R-1.IR_full       241 GTTCGCCTACAGTCCGATAACAGTTGAGCAGATTCTAGTGAACAACAAACTAACGAATCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1560R-1.in silico     241 GTTCGCCTACAGTCCGATAACAGTTGAGCAGATTCTAGTGAACAACAAACTAACGAATCA 300


1560R-1.IR_full       301 ATACAAAGCTGAACTGGCGGCTGGTGGCGGCGGCTCCGCCATGTCCGGCAGCAGCTCAAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1560R-1.in silico     301 ATACAAAGCTGAACTGGCGGCTGGTGGCGGCGGCTCCGCCATGTCCGGCAGCAGCTCAAG 360


1560R-1.IR_full       361 CTCCTACTCGTCGAGTTCGAGCTCGTCGAGCTTCTACTCGCAGAGCTCCTCGGGATCCAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1560R-1.in silico     361 CTCCTACTCGTCGAGTTCGAGCTCGTCGAGCTTCTACTCGCAGAGCTCCTCGGGATCCAG 420


1560R-1.IR_full       421 TTCCGCCAGCGGATACGAAGAGTACTCTGCCGGCGAAATTGTCCAAATCCAACCGCAGTN 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
1560R-1.in silico     421 TTCCGCCAGCGGATACGAAGAGTACTCTGCCGGCGAAATTGTCCAAATCCAACCGCAGT- 480


1560R-1.IR_full       481 CCATGCGANCTCGCATTGGGNACCTC 506
                          |||||||| |||||||||       |
1560R-1.in silico     481 CCATGCGA-CTCGCATTG-------C 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   478  NM_080054.2  CG1560-RA (mys), mRNA 
0.62   NM_135281.1  CG6630-RA (CG6630), mRNA 
0   NM_164749.1  CG5261-RA, transcript variant A (CG5261), mRNA 
0   NM_135274.2  CG5261-RB, transcript variant B (CG5261), mRNA 
0   NM_176480.1  CG33098-RB, transcript variant B (CG33098), mRNA 
0   NM_176481.1  CG33098-RC, transcript variant C (CG33098), mRNA 
0   NM_132655.1  CG1662-RA (CG1662), mRNA 
0   NM_166450.1  CG10497-RC, transcript variant C (Sdc), mRNA 
0   NM_166449.2  CG10497-RB, transcript variant B (Sdc), mRNA 
0   NM_057617.3  CG10497-RA, transcript variant A (Sdc), mRNA 
0   NM_176482.1  CG33098-RD, transcript variant D (CG33098), mRNA 
0   NM_142769.2  CG5383-RA (PSR), mRNA 
0   NM_168477.1  CG32092-RB (CG32092), mRNA 
0   NM_136733.2  CG12907-RA (CG12907), mRNA 
0   NM_206240.1  CG33484-RA, transcript variant A (zormin), mRNA 
0   NM_001043112.1  CG33484-RB, transcript variant B (zormin), mRNA 
0   NM_001043114.1  CG33484-RD, transcript variant D (zormin), mRNA 
0   NM_001043113.1  CG33484-RC, transcript variant C (zormin), mRNA 
0   NM_168802.1  CG32210-RA (CG32210), mRNA 
0   NM_057543.3  CG9998-RA (U2af50), mRNA 
0   NM_001014584.1  CG4879-RC, transcript variant C (RecQ5), mRNA 
0   NM_079346.2  CG4879-RA, transcript variant A (RecQ5), mRNA 
0   NM_139528.2  CG17569-RB, transcript variant B (gry), mRNA 
0   NM_168000.1  CG17569-RA, transcript variant A (gry), mRNA 
0   NM_143316.2  CG5586-RB (Tusp), mRNA 
0   NM_140050.2  CG4022-RA (CG4022), mRNA 
0   NM_143303.1  CG6599-RA (CG6599), mRNA 
0   NM_167469.2  CG10545-RB, transcript variant B (Gbeta13F), mRNA 
0   NM_080351.5  CG10545-RA, transcript variant A (Gbeta13F), mRNA 
0   NM_206737.1  CG10545-RE, transcript variant E (Gbeta13F), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.