National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15552R-2 
 Symbol Sox100B  Full Name Sox100B 
 CG No CG15552  Old CG No CG15552 
 Synonyms CT6009, Sox9, SOXE, SOX100B, CG12098, SoxB, CG18674, CG15552, Sox100B, Sox100 
 Accession No (Link to NCBI) NM_143582.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Jin Z, Chen J, Huang H, Wang J, Lv J, Yu M, Guo X, Zhang Y, Cai T, Xi R.
The Drosophila Ortholog of Mammalian Transcription Factor Sox9 Regulates Intestinal Homeostasis and Regeneration at an Appropriate Level.
Cell Rep (2020) 31(8) 107683 [ PubMed ID = 32460025 ] [ RRC reference ]

Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGGAGCACATCAAGCGACCGA 
 Primer Seq. 3'
aatctagaggtaccCAAACTGGCCGCACAGGCACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGGAGCACAT CAAGCGACCG ATGAACGCCT TCATGGTTTG GGCCCAGGCA GCCCGCAGGG 
0061 TCNATGTCCA AACAGTATCC GCATCTGCAG AACTCCGAAC TGAGCAAATC GCTGGGCAAG 
0121 CTGTGGAAAA ATCTAAAGGA CAGTGATAAG AAGCCCTTCA TGGAATTCGC CGAGAAGCTT 
0181 CGAATGACCC ACAAGCAGGA GCATCCGGAC TACAAGTACC AGCCGCGGCG CAAGAAAGCG 
0241 CGGGTGTTGC CGTCCCAGCA AAGCGGTGAA GGGGGATCCC CGGGTCCAGA GATGACGTTA 
0301 TCCGCCACTA TGGGTAGCTC CGGGAAGCCA AGGAGCAGCA ATTCCAATGG CCAGAGGCGA 
0361 GCGGGCAAGG GAAATGCAGC TGCTGATCTG GNGCagNTGC GCCTCGACCA TCTCCCATGC 
0421 CAATGTGGGC TCGAACTCCT CGGATGTCTT CAGTAATGAG GCCTTCATGA AATCCCTGAA 
0481 CANTGNCTGT gCGGCCAGTT TG 
 in silico PCR Fragment
0001 AGGAGCACAT CAAGCGACCG ATGAACGCCT TCATGGTTTG GGCCCAGGCA GCCCGCAGGG 
0061 TC-ATGTCCA AACAGTATCC GCATCTGCAG AACTCCGAAC TGAGCAAATC GCTGGGCAAG 
0121 CTGTGGAAAA ATCTAAAGGA CAGTGATAAG AAGCCCTTCA TGGAATTCGC CGAGAAGCTT 
0181 CGAATGACCC ACAAGCAGGA GCATCCGGAC TACAAGTACC AGCCGCGGCG CAAGAAAGCG 
0241 CGGGTGTTGC CGTCCCAGCA AAGCGGTGAA GGGGGATCCC CGGGTCCAGA GATGACGTTA 
0301 TCCGCCACTA TGGGTAGCTC CGGGAAGCCA AGGAGCAGCA ATTCCAATGG CCAGAGGCGA 
0361 GCGGGCAAGG GAAATGCAGC TGCTGATCTG G-GCAGCTGC GCCTCGACCA TCTCCCATGC 
0421 CAATGTGGGC TCGAACTCCT CGGATGTCTT CAGTAATGAG GCCTTCATGA AATCCCTGAA 
0481 CAGTGCCTGT GCGGCCAGTT TG 
 Assemble Data

15552R-2.IR_full       1   AGGAGCACATCAAGCGACCGATGAACGCCTTCATGGTTTGGGCCCAGGCAGCCCGCAGGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15552R-2.in silico     1   AGGAGCACATCAAGCGACCGATGAACGCCTTCATGGTTTGGGCCCAGGCAGCCCGCAGGG 60


15552R-2.IR_full       61  TCNATGTCCAAACAGTATCCGCATCTGCAGAACTCCGAACTGAGCAAATCGCTGGGCAAG 120
                           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15552R-2.in silico     61  TC-ATGTCCAAACAGTATCCGCATCTGCAGAACTCCGAACTGAGCAAATCGCTGGGCAAG 120


15552R-2.IR_full       121 CTGTGGAAAAATCTAAAGGACAGTGATAAGAAGCCCTTCATGGAATTCGCCGAGAAGCTT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15552R-2.in silico     121 CTGTGGAAAAATCTAAAGGACAGTGATAAGAAGCCCTTCATGGAATTCGCCGAGAAGCTT 180


15552R-2.IR_full       181 CGAATGACCCACAAGCAGGAGCATCCGGACTACAAGTACCAGCCGCGGCGCAAGAAAGCG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15552R-2.in silico     181 CGAATGACCCACAAGCAGGAGCATCCGGACTACAAGTACCAGCCGCGGCGCAAGAAAGCG 240


15552R-2.IR_full       241 CGGGTGTTGCCGTCCCAGCAAAGCGGTGAAGGGGGATCCCCGGGTCCAGAGATGACGTTA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15552R-2.in silico     241 CGGGTGTTGCCGTCCCAGCAAAGCGGTGAAGGGGGATCCCCGGGTCCAGAGATGACGTTA 300


15552R-2.IR_full       301 TCCGCCACTATGGGTAGCTCCGGGAAGCCAAGGAGCAGCAATTCCAATGGCCAGAGGCGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15552R-2.in silico     301 TCCGCCACTATGGGTAGCTCCGGGAAGCCAAGGAGCAGCAATTCCAATGGCCAGAGGCGA 360


15552R-2.IR_full       361 GCGGGCAAGGGAAATGCAGCTGCTGATCTGGNGCAGNTGCGCCTCGACCATCTCCCATGC 420
                           ||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||
15552R-2.in silico     361 GCGGGCAAGGGAAATGCAGCTGCTGATCTGG-GCAGCTGCGCCTCGACCATCTCCCATGC 420


15552R-2.IR_full       421 CAATGTGGGCTCGAACTCCTCGGATGTCTTCAGTAATGAGGCCTTCATGAAATCCCTGAA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15552R-2.in silico     421 CAATGTGGGCTCGAACTCCTCGGATGTCTTCAGTAATGAGGCCTTCATGAAATCCCTGAA 480


15552R-2.IR_full       481 CANTGNCTGTGCGGCCAGTTTG 502
                           || || ||||||||||||||||
15552R-2.in silico     481 CAGTGCCTGTGCGGCCAGTTTG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143582.1  CG15552-RA (Sox100B), mRNA 
1.24   16  11  NM_079996.2  CG18024-RA (SoxN), mRNA 
0.62   13  11  13  NM_057546.2  CG3090-RA, transcript variant A (Sox14), mRNA 
0.62   13  11  11  NM_134290.1  CG3090-RB, transcript variant B (Sox14), mRNA 
0.41   16  13  NM_079015.2  CG8404-RA (Sox15), mRNA 
0.2   NM_165611.1  CG8643-RA (rgr), mRNA 
0   17  26  NM_079342.2  CG5893-RA (D), mRNA 
0   NM_136834.1  CG13204-RA, transcript variant A (CG13204), mRNA 
0   NM_165827.1  CG13204-RB, transcript variant B (CG13204), mRNA 
0   NM_139465.1  CG16762-RA (CG16762), mRNA 
0   NM_078799.2  CG3779-RA, transcript variant A (numb), mRNA 
0   NM_164855.1  CG3779-RB, transcript variant B (numb), mRNA 
0   NM_169222.2  CG31462-RA (CG31462), mRNA 
0   NM_137743.2  CG30283-RA (CG30283), mRNA 
0   NM_132057.2  CG14447-RA (Grip), mRNA 
0   NM_136979.2  CG3790-RA (CG3790), mRNA 
0   NM_136557.2  CG8635-RA (CG8635), mRNA 
0   NM_165099.1  CG7595-RA, transcript variant A (ck), mRNA 
0   NM_078847.2  CG7595-RB, transcript variant B (ck), mRNA 
0   NM_001038919.1  CG33991-RE, transcript variant E (nuf), mRNA 
0   NM_176736.1  CG15643-RA (CG15643), mRNA 
0   NM_144278.2  CG15345-RA (CG15345), mRNA 
0   NM_057970.3  CG6438-RA (amon), mRNA 
0   NM_169833.1  CG7717-RB, transcript variant B (Mekk1), mRNA 
0   NM_142493.2  CG7717-RA, transcript variant A (Mekk1), mRNA 
0   19  12  NM_140437.1  CG7345-RA (Sox21a), mRNA 
0   22  NM_140438.2  CG32139-RA (Sox21b), mRNA 
0   NM_136442.3  CG1621-RA (CG1621), mRNA 
0   NM_169874.1  CG4608-RA (bnl), mRNA 
0   10  NM_176735.1  CG33206-RB, transcript variant B (l(1)G0168), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.