National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15509R-2 
 Symbol kay  Full Name kayak 
 CG No CG33956  Old CG No CG15509 
 Synonyms CG15509, CG15507, DFos, AP-1, Dfos, DFOS, D-fos, D-Fos, fos, Fos, AP1, d-fos, c-Fos, sro, dFRA, dFos, Fra, DFra, dFra, dAP-1, dlhD, CG33956, kay, D-fos/kay 
 Accession No (Link to NCBI) NM_001032407.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Ling J, Dubruille R, Emery P.
KAYAK-α modulates circadian transcriptional feedback loops in Drosophila pacemaker neurons.
J. Neurosci. (2012) 32(47) 16959-70 [ PubMed ID = 23175847 ] [ RRC reference ]

Brock AR, Wang Y, Berger S, Renkawitz-Pohl R, Han VC, Wu Y, Galko MJ.
Transcriptional regulation of Profilin during wound closure in Drosophila larvae.
J. Cell. Sci. (2012) 125(Pt 23) 5667-76 [ PubMed ID = 22976306 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGCCATCAGAAAGCCCGAGGATCCAGATCCGGCGGAAGAGGACAGGGTCAAGATGGTGCA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGATGACCCAGAGGACCAGGAGAACCAGGCGGTGGATGAGGAGGAGCTGGACTTTCTGCC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGCCGATCTAAGCGCTGCGATATCGACGGCGACAACGAAAATAGCAACACCGACGCGCAA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCTTATCCTCGGCAACTTTGAGACCGGCCAGAGTGTTCTCACACTGACGACGCCCACGTT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GACGCCGACCACCACGCGCAACATCGAGGACACACTGGGCCACTTGCTCTCGGACACGCA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GACCGATCGTGTGGCTGGTTGCGCGGGATTTGCAGTGCCAAAGGTGCTACCCAATGCCAT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGATGTCCTGGGCATGGGTATTCCCACCGGTGTTTCGTCGCTCCCACTTCAGCAGACATT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CGATTTGAGCCTGGGGCAGGGCAGCGAGTCCGAGGACTCCAACGCTTCGTACAACGATAC 480

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     481 GCAGATGAACGAGGAGCAGGACACGACCGATACTTCAAGTGCCCATACGGACAGCACCTC 540

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     541 GTACCAAGCTGGCCACATCATGGCGGGCAGCGTGAACGGCGGCGGTGTCAACAACT 596

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   578  NM_001032407.1  CG33956-RA, transcript variant A (kay), mRNA 
67.64   391  NM_001032406.1  CG33956-RB, transcript variant B (kay), mRNA 
67.64   391  NM_001032405.1  CG33956-RE, transcript variant E (kay), mRNA 
67.64   391  NM_001032408.1  CG33956-RD, transcript variant D (kay), mRNA 
0.51   NM_143348.2  CG4849-RA (CG4849), mRNA 
0.51   NM_170363.1  CG31054-RA (CG31054), mRNA 
0.17   NM_135461.2  CG4364-RA (CG4364), mRNA 
0   NM_137821.2  CG10955-RA (CG10955), mRNA 
0   NM_139904.1  CG8281-RA (CG8281), mRNA 
0   NM_132346.1  CG3003-RB (CG3003), mRNA 
0   NM_170651.3  CG17077-RD, transcript variant D (pnt), mRNA 
0   NM_170070.1  CG17077-RC, transcript variant C (pnt), mRNA 
0   NM_079737.2  CG17077-RB, transcript variant B (pnt), mRNA 
0   NM_143969.1  CG17208-RA (CG17208), mRNA 
0   NM_136982.2  CG3850-RA (sug), mRNA 
0   NM_079717.2  CG6703-RB, transcript variant B (Caki), mRNA 
0   NM_145193.1  CG30185-RA (CG30185), mRNA 
0   12  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   12  NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   11  NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
0   NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_166130.1  CG18255-RE, transcript variant E (Strn-Mlck), mRNA 
0   NM_169790.1  CG7913-RA, transcript variant A (PP2A-B'), mRNA 
0   NM_169789.1  CG7913-RB, transcript variant B (PP2A-B'), mRNA 
0   NM_169022.1  CG31536-RA, transcript variant A (Cdep), mRNA 
0   NM_001043211.1  CG31536-RE, transcript variant E (Cdep), mRNA 
0   NM_169023.1  CG31536-RB, transcript variant B (Cdep), mRNA 
0   NM_169088.1  CG1250-RA, transcript variant A (sec23), mRNA 
0   NM_169089.2  CG1250-RB, transcript variant B (sec23), mRNA 
0   NM_176133.3  CG12052-RI, transcript variant I (lola), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.