National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15507R-4 
 Symbol kay  Full Name kayak 
 CG No CG33956  Old CG No CG15507 
 Synonyms CG15509, CG15507, DFos, AP-1, Dfos, DFOS, D-fos, D-Fos, fos, Fos, AP1, d-fos, c-Fos, sro, dFRA, dFos, Fra, DFra, dFra, dAP-1, dlhD, CG33956, kay, D-fos/kay 
 Accession No (Link to NCBI) NM_001032408.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Rallis A, Moore C, Ng J.
Signal strength and signal duration define two distinct aspects of JNK-regulated axon stability.
Dev Biol (2010) 339(1) 65-77 [ PubMed ID = 20035736 ] [ RRC reference ]

Ling J, Dubruille R, Emery P.
KAYAK-α modulates circadian transcriptional feedback loops in Drosophila pacemaker neurons.
J Neurosci (2012) 32(47) 16959-70 [ PubMed ID = 23175847 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev Biol (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      1   ATTGCACTAAAGGCCACCGAGATGCAGCACAACAACAACGCATTGCAGCAGCAGCAGCA 59

                           ||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| silico     61  ACTGCAGCATCAACTGCTGCAGCAACATCAGCAGCAGCATCAGCA-GCAGCTGCAGCAGC 119

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AGCTCAATTCGCCCGATAATAATTATATTTGGGCAACCACGCACAATGCGAATATCAGCA 179

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAAACAACGCAATGTTGCAGCTGCAGCAGCAACAACTGCGTGCCCCCTGGATAACCGATT 239

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCAACAAGCAGCACCACATTAACAACAATAACAGCATGAATGTCAATTACAATCAGCAAT 299

                           |||||| |||||||||||||||||||||||||   ||||||||||||||||||||||||| silico     301 TGACGC-AACAGCCGCAGCAGCAGCAGCAGCA---AACGCAGTACATGCAACACAATTAC 359

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AACAACTACACGCAACAGCAGCAGCAGCAGCATCTAGTGCCCGCAACAACATCCCAATCC 419

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AACAGCCACTTCTACCAGTGCAACCAGCAGCAGCAGCAGCAGCAATTCCTGGCGCCCACC 479

15507R-4.IR_full       481 ACCACAACAGCAGCAGTGGTAGTAG 504
                           ||||||||||||||||||||||||| silico     481 ACCACAACAGCAGCAGTGGTAGTAG 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.41  484  52  337  863  NM_001032408.1  CG33956-RD, transcript variant D (kay), mRNA 
27.8   134  1092  3587  6904  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
27.8   134  1092  3587  6904  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
27.8   134  1092  3587  6904  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
7.67   37  401  1491  3449  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
7.67   37  401  1491  3449  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
6.63   32  108  341  830  NM_205900.1  CG3327-RC, transcript variant C (E23), mRNA 
6.63   32  108  341  830  NM_079909.2  CG3327-RA, transcript variant A (E23), mRNA 
6.01   29  266  996  2164  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
6.01   29  266  996  2164  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
6.01   29  232  807  1522  NM_134474.4  CG32532-RA (CG32532), mRNA 
5.8   28  263  724  1272  NM_001014565.1  CG10491-RB, transcript variant B (vn), mRNA 
5.8   28  263  724  1272  NM_079218.2  CG10491-RA, transcript variant A (vn), mRNA 
5.8   28  262  1131  2814  NM_001038734.1  CG16902-RC (Hr4), mRNA 
5.6   27  274  1024  2251  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
5.6   27  250  867  1792  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
5.39   26  218  850  2283  NM_168571.2  CG32133-RA (CG32133), mRNA 
5.39   26  185  538  980  NM_132665.1  CG15753-RA (CG15753), mRNA 
5.18   25  202  652  1278  NM_137721.1  CG18375-RA, transcript variant A (CG18375), mRNA 
5.18   25  202  646  1198  NM_176243.1  CG18375-RB, transcript variant B (CG18375), mRNA 
4.97   24  223  562  1166  NM_167239.2  CG32677-RA (CG32677), mRNA 
4.97   24  186  601  1134  NM_132172.2  CG15478-RA (CG15478), mRNA 
4.97   24  155  487  941  NM_001042796.1  CG6775-RC, transcript variant C (rg), mRNA 
4.97   24  155  487  941  NM_080023.1  CG6775-RA, transcript variant A (rg), mRNA 
4.97   24  155  487  941  NM_167028.1  CG6775-RB, transcript variant B (rg), mRNA 
4.97   24  92  336  711  NM_137046.3  CG6191-RA (CG6191), mRNA 
4.77   23  203  378  419  NM_144133.1  CG13235-RA (CG13235), mRNA 
4.77   23  188  738  1663  NM_079845.2  CG7951-RA (sima), mRNA 
4.77   23  179  585  1069  NM_169657.1  CG5166-RB, transcript variant B (Atx2), mRNA 
4.77   23  179  582  1053  NM_169658.2  CG5166-RC, transcript variant C (Atx2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.