National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15507R-2 
 Symbol kay  Full Name kayak 
 CG No CG33956  Old CG No CG15507 
 Synonyms CG15509, CG15507, DFos, AP-1, Dfos, DFOS, D-fos, D-Fos, fos, Fos, AP1, d-fos, c-Fos, sro, dFRA, dFos, Fra, DFra, dFra, dAP-1, dlhD, CG33956, kay, D-fos/kay 
 Accession No (Link to NCBI) NM_001032408.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Chang YC, Tu H, Chen JY, Chang CC, Yang SY, Pi H.
Reproduction disrupts stem cell homeostasis in testes of aged male Drosophila via an induced microenvironment.
PLoS Genet. (2019) 15(7) e1008062 [ PubMed ID = 31295251 ] [ RRC reference ]

Ling J, Dubruille R, Emery P.
KAYAK-α modulates circadian transcriptional feedback loops in Drosophila pacemaker neurons.
J. Neurosci. (2012) 32(47) 16959-70 [ PubMed ID = 23175847 ] [ RRC reference ]

Mummery-Widmer JL, Yamazaki M, Stoeger T, Novatchkova M, Bhalerao S, Chen D, Dietzl G, Dickson BJ, Knoblich JA.
Genome-wide analysis of Notch signalling in Drosophila by transgenic RNAi.
Nature (2009) 458(7241) 987-92 [ PubMed ID = 19363474 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATTGCACTAAAGGCCACCGA 
 Primer Seq. 3'
aatctagaggtaccCTACTACCACTGCTGCTGTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NATTGCACTA AAGGCCACCG AGATGCAGCA CAACAACAAC GCATTGCAGC AGCaGCAGCA 
0061 ACTGCAGCAT CAACTGCTGC AGCAACATCA GCAGCAGTAT CAGCANGCAG CTGCAGCAGC 
0121 AGCTCAATTC GCCCGATAAT AATTATATTT GGGCAACCAC GCACAATGCG AATATCAGCA 
0181 GAAACAACGC AATGTTGCAG CTGCAGCAGC AACAACTGCG TGCCCCCTGG ATAACCGATT 
0241 GCAACAAGCA GCACCACATT AACAACAATA ACAGCATGAA TGTCAATTAC AATCAGCAAT 
0301 TGACGCAAAC AGCCGCAGCA GCAGCAGCAG CAGCTAACGC AGTACATGCA ACACAATTAC 
0361 AACAACTACA CGCAACAGCA GCAGCAGCAG CATCTAGTGC CCGCAACAAC ATCCCAATCC 
0421 AACAGCCACT TCTACCAGTG CAACCAGCAG CAGCAGCAGC AGCAATTCCT GGCGCCCACC 
0481 ACCACAACAG CAGCAGTGGT AGTAG 
 in silico PCR Fragment
0001 GATTGCACTA AAGGCCACCG AGATGCAGCA CAACAACAAC GCATTGCAGC AGCAGCAGCA 
0061 ACTGCAGCAT CAACTGCTGC AGCAACATCA GCAGCAGCAT CAGCA-GCAG CTGCAGCAGC 
0121 AGCTCAATTC GCCCGATAAT AATTATATTT GGGCAACCAC GCACAATGCG AATATCAGCA 
0181 GAAACAACGC AATGTTGCAG CTGCAGCAGC AACAACTGCG TGCCCCCTGG ATAACCGATT 
0241 GCAACAAGCA GCACCACATT AACAACAATA ACAGCATGAA TGTCAATTAC AATCAGCAAT 
0301 TGACGC-AAC AGCCGCAGCA GCAGCAGCAG CA---AACGC AGTACATGCA ACACAATTAC 
0361 AACAACTACA CGCAACAGCA GCAGCAGCAG CATCTAGTGC CCGCAACAAC ATCCCAATCC 
0421 AACAGCCACT TCTACCAGTG CAACCAGCAG CAGCAGCAGC AGCAATTCCT GGCGCCCACC 
0481 ACCACAACAG CAGCAGTGGT AGTAG 
 Assemble Data

15507R-2.IR_full        1   ATTGCACTAAAGGCCACCGAGATGCAGCACAACAACAACGCATTGCAGCAGCAGCAGCA 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15507R-2.in silico      1   ATTGCACTAAAGGCCACCGAGATGCAGCACAACAACAACGCATTGCAGCAGCAGCAGCA 59


15507R-2.IR_full       61  ACTGCAGCATCAACTGCTGCAGCAACATCAGCAGCAGTATCAGCANGCAGCTGCAGCAGC 119
                           ||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||
15507R-2.in silico     61  ACTGCAGCATCAACTGCTGCAGCAACATCAGCAGCAGCATCAGCA-GCAGCTGCAGCAGC 119


15507R-2.IR_full       121 AGCTCAATTCGCCCGATAATAATTATATTTGGGCAACCACGCACAATGCGAATATCAGCA 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15507R-2.in silico     121 AGCTCAATTCGCCCGATAATAATTATATTTGGGCAACCACGCACAATGCGAATATCAGCA 179


15507R-2.IR_full       181 GAAACAACGCAATGTTGCAGCTGCAGCAGCAACAACTGCGTGCCCCCTGGATAACCGATT 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15507R-2.in silico     181 GAAACAACGCAATGTTGCAGCTGCAGCAGCAACAACTGCGTGCCCCCTGGATAACCGATT 239


15507R-2.IR_full       241 GCAACAAGCAGCACCACATTAACAACAATAACAGCATGAATGTCAATTACAATCAGCAAT 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15507R-2.in silico     241 GCAACAAGCAGCACCACATTAACAACAATAACAGCATGAATGTCAATTACAATCAGCAAT 299


15507R-2.IR_full       301 TGACGCAAACAGCCGCAGCAGCAGCAGCAGCAGCTAACGCAGTACATGCAACACAATTAC 359
                           |||||| |||||||||||||||||||||||||   |||||||||||||||||||||||||
15507R-2.in silico     301 TGACGC-AACAGCCGCAGCAGCAGCAGCAGCA---AACGCAGTACATGCAACACAATTAC 359


15507R-2.IR_full       361 AACAACTACACGCAACAGCAGCAGCAGCAGCATCTAGTGCCCGCAACAACATCCCAATCC 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15507R-2.in silico     361 AACAACTACACGCAACAGCAGCAGCAGCAGCATCTAGTGCCCGCAACAACATCCCAATCC 419


15507R-2.IR_full       421 AACAGCCACTTCTACCAGTGCAACCAGCAGCAGCAGCAGCAGCAATTCCTGGCGCCCACC 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15507R-2.in silico     421 AACAGCCACTTCTACCAGTGCAACCAGCAGCAGCAGCAGCAGCAATTCCTGGCGCCCACC 479


15507R-2.IR_full       481 ACCACAACAGCAGCAGTGGTAGTAG 504
                           |||||||||||||||||||||||||
15507R-2.in silico     481 ACCACAACAGCAGCAGTGGTAGTAG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.41  484  52  337  863  NM_001032408.1  CG33956-RD, transcript variant D (kay), mRNA 
27.8   134  1092  3587  6904  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
27.8   134  1092  3587  6904  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
27.8   134  1092  3587  6904  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
7.67   37  401  1491  3449  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
7.67   37  401  1491  3449  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
6.63   32  108  341  830  NM_205900.1  CG3327-RC, transcript variant C (E23), mRNA 
6.63   32  108  341  830  NM_079909.2  CG3327-RA, transcript variant A (E23), mRNA 
6.01   29  266  996  2164  NM_206628.1  CG32767-RB, transcript variant B (CG32767), mRNA 
6.01   29  266  996  2164  NM_131975.3  CG32767-RA, transcript variant A (CG32767), mRNA 
6.01   29  232  807  1522  NM_134474.4  CG32532-RA (CG32532), mRNA 
5.8   28  263  724  1272  NM_001014565.1  CG10491-RB, transcript variant B (vn), mRNA 
5.8   28  263  724  1272  NM_079218.2  CG10491-RA, transcript variant A (vn), mRNA 
5.8   28  262  1131  2814  NM_001038734.1  CG16902-RC (Hr4), mRNA 
5.6   27  274  1024  2251  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
5.6   27  250  867  1792  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
5.39   26  218  850  2283  NM_168571.2  CG32133-RA (CG32133), mRNA 
5.39   26  185  538  980  NM_132665.1  CG15753-RA (CG15753), mRNA 
5.18   25  202  652  1278  NM_137721.1  CG18375-RA, transcript variant A (CG18375), mRNA 
5.18   25  202  646  1198  NM_176243.1  CG18375-RB, transcript variant B (CG18375), mRNA 
4.97   24  223  562  1166  NM_167239.2  CG32677-RA (CG32677), mRNA 
4.97   24  186  601  1134  NM_132172.2  CG15478-RA (CG15478), mRNA 
4.97   24  155  487  941  NM_001042796.1  CG6775-RC, transcript variant C (rg), mRNA 
4.97   24  155  487  941  NM_080023.1  CG6775-RA, transcript variant A (rg), mRNA 
4.97   24  155  487  941  NM_167028.1  CG6775-RB, transcript variant B (rg), mRNA 
4.97   24  92  336  711  NM_137046.3  CG6191-RA (CG6191), mRNA 
4.77   23  203  378  419  NM_144133.1  CG13235-RA (CG13235), mRNA 
4.77   23  188  738  1663  NM_079845.2  CG7951-RA (sima), mRNA 
4.77   23  179  585  1069  NM_169657.1  CG5166-RB, transcript variant B (Atx2), mRNA 
4.77   23  179  582  1053  NM_169658.2  CG5166-RC, transcript variant C (Atx2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.