National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15483R-3 
 Symbol CG15483  Full Name CG15483 
 CG No CG15483  Old CG No CG15483 
 Synonyms CG15483 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGTTTCGAATCTCTGGCCTTCTGAGTTCACTCGTAGTCCTTACTTTTGTTCTGGAAATC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     61  AGTTGCCTGGAGAATGGCACCCTGGCCAAGCTGAAAAAGTTTGTGAACTGCGAGTCTAAG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCTTACAAGTCCAGCAATGCGATCTACAAGGATTACTGGGTGCTGGAAAACTATGTAATG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCTGATCACGGCGATATTCCGTGCTATTCGAATGTGACCTACACCACCCATGCGGACTAT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACGTATCTGGATAATGTGGTGCCGCTCCTGGAACGCTGGCGATCGCCCCTCAGCCTGGCC 300

                           ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATATATGCTCCTGGCACGGACTTCGAGCCCACTATACACAGCATTTTGTACCTGCTGCAG 360

                           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGCCATCCTGGCCACGACCTGGTTCGCCAGCTGTGCAGCATTCATTTGTACTTCGATGTG 420

                           |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| silico     421 GAGCACTTGCCCCAGGTGGTTCTGCCACCCGAAACGACTCTAAGGGAGCCAGCCAACTGT 480

15483R-3.IR full       481 AGTGGACCACCGCCATATGAG 501
                           |||||||||||||||||||| silico     481 AGTGGACCACCGCCATATGA- 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_135748.1  CG15483-RA (CG15483), mRNA 
10  27  NM_164661.1  CG31912-RA (CG31912), mRNA 
10  27  NM_164660.1  CG9171-RA, transcript variant A (CG9171), mRNA 
10  27  NM_135114.2  CG9171-RB, transcript variant B (CG9171), mRNA 
NM_141453.2  CG1234-RA (CG1234), mRNA 
NM_142054.1  CG14365-RA (CG14365), mRNA 
NM_206265.1  karst CG12008-RC, transcript variant C (kst), mRNA 
NM_206266.1  karst CG12008-RB, transcript variant B (kst), mRNA 
NM_079176.1  karst CG12008-RA, transcript variant A (kst), mRNA 
NM_165838.2  invected CG17835-RC, transcript variant C (inv), mRNA 
NM_078975.3  invected CG17835-RB, transcript variant B (inv), mRNA 
NM_165837.2  invected CG17835-RA, transcript variant A (inv), mRNA 
NM_165839.2  invected CG17835-RD, transcript variant D (inv), mRNA 
NM_140256.4  CG11597-RA, transcript variant A (CG11597), mRNA 
NM_001043137.1  CG11597-RB, transcript variant B (CG11597), mRNA 
NM_134992.2  CG15439-RA (CG15439), mRNA 
NM_136891.2  prp8 CG8877-RA (prp8), mRNA 
NM_166055.1  phyllopod CG10108-RA (phyl), mRNA 
NM_143421.2  CG11897-RB, transcript variant B (CG11897), mRNA 
NM_170399.1  CG11897-RA, transcript variant A (CG11897), mRNA 
NM_144176.1  CG12521-RA (CG12521), mRNA 
NM_206455.1  48 related 1 CG33323-RA (Fer1), mRNA 
NM_143035.3  CG6995-RA, transcript variant A (CG6995), mRNA 
NM_001038977.1  CG6995-RC, transcript variant C (CG6995), mRNA 
NM_001043084.1  CG34123-RD, transcript variant D (CG34123), mRNA 
NM_001043083.1  CG34123-RB, transcript variant B (CG34123), mRNA 
NM_001043085.1  CG34123-RC, transcript variant C (CG34123), mRNA 
NM_165341.1  diaphanous CG1768-RB, transcript variant B (dia), mRNA 
NM_057633.3  diaphanous CG1768-RA, transcript variant A (dia), mRNA 
NM_132259.2  PIP82 CG11219-RA (PIP82), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.