National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15433R-3 
 Symbol Elp3  Full Name Elp3 
 CG No CG15433  Old CG No CG15433 
 Synonyms dmHAG408, Dmel/ELP3, HAT, Elp3, Dmel?ELP3, CG15433 
 Accession No (Link to NCBI) NM_134990.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Walker J, Kwon SY, Badenhorst P, East P, McNeill H, Svejstrup JQ.
Role of elongator subunit Elp3 in Drosophila melanogaster larval development and immunity.
Genetics (2011) 187(4) 1067-75 [ PubMed ID = 21288872 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCTTCAGACCCGACACCGCGT 
 Primer Seq. 3'
aatctagaggtaccAGCGGAAGGCAGGGTTCTCAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCTTCAGACC CGACACCGCG TTGAACAGCT GAAGCAGCTG GGACACAGTG TGGACAAGGT 
0061 GGAGTTCATC GTAATGGGCG GTACGTTCAT GTGCCTGCCG GAGGAGTACC GCGACTACTT 
0121 TATCCGCAAC CTACACNGAC GCCCTCTCCG GCCACAGCAG CGCCAATGTG GCGGAAGCCG 
0181 TANCGCTACT CGGAGAAGTC ACGCACAAAG TGCATTGGCA TCACCATAGA AACAAGGCCA 
0241 GATTACTGCC TAAAGCGGCA CATATCGGAT ATGCTTAGCT ATGGTTGCAC CCGGCTGGAA 
0301 ATCGGTGTGC AATCGGTTTA CGANAGACGT GGCCAGGGAT ACGAACCGCG GACACACGGT 
0361 GCGAGCGGTG TGCGAGAGCT TCCAGCTGGG CAAGGATGCT GGCTACAAGA TCGTGACGCA 
0421 CATGATGCCT GATCTTCCCA ATGTTGACTT TGAACGCGAC ATCGAGCAGT TTATCGAGTA 
0481 CTTTGAGAAC CCTGCCTTCC GCT 
 in silico PCR Fragment
0001 TCTTCAGACC CGACACCGCG TTGAACAGCT GAAGCAGCTG GGACACAGTG TGGACAAGGT 
0061 GGAGTTCATC GTAATGGGCG GTACGTTCAT GTGCCTGCCG GAGGAGTACC GCGACTACTT 
0121 TATCCGCAAC CTACAC-GAC GCCCTCTCCG GCCACAGCAG CGCCAATGTG GCGGAAGCCG 
0181 TA-CGCTACT CGGAGAAGTC ACGCACAAAG TGCATTGGCA TCACCATAGA AACAAGGCCA 
0241 GATTACTGCC TAAAGCGGCA CATATCGGAT ATGCTTAGCT ATGGTTGCAC CCGGCTGGAA 
0301 ATCGGTGTGC AATCGGTTTA CGA-AGACGT GGCCAGGGAT ACGAACCGCG GACACACGGT 
0361 GCGAGCGGTG TGCGAGAGCT TCCAGCTGGG CAAGGATGCT GGCTATAAGA TCGTGACGCA 
0421 CATGATGCCT GATCTTCCCA ATGTTGACTT TGAACGCGAC ATCGAGCAGT TTATCGAGTA 
0481 CTTTGAGAAC CCTGCCTTCC GCT 
 Assemble Data

15433R-3.IR_full       1   TCTTCAGACCCGACACCGCGTTGAACAGCTGAAGCAGCTGGGACACAGTGTGGACAAGGT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15433R-3.in silico     1   TCTTCAGACCCGACACCGCGTTGAACAGCTGAAGCAGCTGGGACACAGTGTGGACAAGGT 60


15433R-3.IR_full       61  GGAGTTCATCGTAATGGGCGGTACGTTCATGTGCCTGCCGGAGGAGTACCGCGACTACTT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15433R-3.in silico     61  GGAGTTCATCGTAATGGGCGGTACGTTCATGTGCCTGCCGGAGGAGTACCGCGACTACTT 120


15433R-3.IR_full       121 TATCCGCAACCTACACNGACGCCCTCTCCGGCCACAGCAGCGCCAATGTGGCGGAAGCCG 180
                           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
15433R-3.in silico     121 TATCCGCAACCTACAC-GACGCCCTCTCCGGCCACAGCAGCGCCAATGTGGCGGAAGCCG 180


15433R-3.IR_full       181 TANCGCTACTCGGAGAAGTCACGCACAAAGTGCATTGGCATCACCATAGAAACAAGGCCA 240
                           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15433R-3.in silico     181 TA-CGCTACTCGGAGAAGTCACGCACAAAGTGCATTGGCATCACCATAGAAACAAGGCCA 240


15433R-3.IR_full       241 GATTACTGCCTAAAGCGGCACATATCGGATATGCTTAGCTATGGTTGCACCCGGCTGGAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15433R-3.in silico     241 GATTACTGCCTAAAGCGGCACATATCGGATATGCTTAGCTATGGTTGCACCCGGCTGGAA 300


15433R-3.IR_full       301 ATCGGTGTGCAATCGGTTTACGANAGACGTGGCCAGGGATACGAACCGCGGACACACGGT 360
                           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
15433R-3.in silico     301 ATCGGTGTGCAATCGGTTTACGA-AGACGTGGCCAGGGATACGAACCGCGGACACACGGT 360


15433R-3.IR_full       361 GCGAGCGGTGTGCGAGAGCTTCCAGCTGGGCAAGGATGCTGGCTACAAGATCGTGACGCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
15433R-3.in silico     361 GCGAGCGGTGTGCGAGAGCTTCCAGCTGGGCAAGGATGCTGGCTATAAGATCGTGACGCA 420


15433R-3.IR_full       421 CATGATGCCTGATCTTCCCAATGTTGACTTTGAACGCGACATCGAGCAGTTTATCGAGTA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15433R-3.in silico     421 CATGATGCCTGATCTTCCCAATGTTGACTTTGAACGCGACATCGAGCAGTTTATCGAGTA 480


15433R-3.IR_full       481 CTTTGAGAACCCTGCCTTCCGCT 503
                           |||||||||||||||||||||||
15433R-3.in silico     481 CTTTGAGAACCCTGCCTTCCGCT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134990.2  CG15433-RA (CG15433), mRNA 
0   NM_136192.2  CG2508-RA (cdc23), mRNA 
0   NM_165331.2  CG31687-RA (CG31687), mRNA 
0   NM_134495.2  CG12234-RA (Ranbp21), mRNA 
0   NM_169972.1  CG31336-RA (Gr93b), mRNA 
0   NM_169870.1  CG6184-RB, transcript variant B (CG6184), mRNA 
0   NM_142567.1  CG6184-RA, transcript variant A (CG6184), mRNA 
0   NM_169871.1  CG6184-RC, transcript variant C (CG6184), mRNA 
0   NM_134927.1  CG15412-RA (CG15412), mRNA 
0   NM_134504.2  CG14232-RA (CG14232), mRNA 
0   NM_057214.3  CG4807-RA, transcript variant A (ab), mRNA 
0   NM_057215.3  CG4807-RB, transcript variant B (ab), mRNA 
0   NM_176458.2  CG4509-RB (CG4509), mRNA 
0   NM_137944.2  CG9891-RA (yellow-d2), mRNA 
0   NM_141932.2  CG11466-RA, transcript variant A (Cyp9f2), mRNA 
0   NM_206478.1  CG11466-RB, transcript variant B (Cyp9f2), mRNA 
0   NM_079647.2  CG8884-RF, transcript variant F (Sap47), mRNA 
0   NM_169690.1  CG8884-RB, transcript variant B (Sap47), mRNA 
0   NM_169685.1  CG8884-RC, transcript variant C (Sap47), mRNA 
0   NM_169689.1  CG8884-RG, transcript variant G (Sap47), mRNA 
0   NM_169687.1  CG8884-RE, transcript variant E (Sap47), mRNA 
0   NM_169686.1  CG8884-RD, transcript variant D (Sap47), mRNA 
0   NM_169684.1  CG8884-RA, transcript variant A (Sap47), mRNA 
0   NM_169688.1  CG8884-RH, transcript variant H (Sap47), mRNA 
0   NM_166934.1  CG3191-RA (CG3191), mRNA 
0   NM_143153.2  CG4719-RA (tankyrase), mRNA 
0   NM_057632.3  CG10072-RA (sgl), mRNA 
0   NM_136774.1  CG12325-RA (CG12325), mRNA 
0   NM_138984.2  CG5712-RA (ACXD), mRNA 
0   NM_168126.1  CG5406-RB, transcript variant B (sif), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
++ 
DC
++ 
DM
VM
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
VM
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.