National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15433R-2 
 Symbol Elp3  Full Name Elp3 
 CG No CG15433  Old CG No CG15433 
 Synonyms dmHAG408, Dmel/ELP3, HAT, Elp3, Dmel?ELP3, CG15433 
 Accession No (Link to NCBI) NM_134990.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Walker J, Kwon SY, Badenhorst P, East P, McNeill H, Svejstrup JQ.
Role of elongator subunit Elp3 in Drosophila melanogaster larval development and immunity.
Genetics (2011) 187(4) 1067-75 [ PubMed ID = 21288872 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TCTTCAGACCCGACACCGCGTTGAACAGCTGAAGCAGCTGGGACACAGTGTGGACAAGGT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGAGTTCATCGTAATGGGCGGTACGTTCATGTGCCTGCCGGAGGAGTACCGCGACTACTT 120

                           |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| silico     121 TATCCGCAACCTACAC-GACGCCCTCTCCGGCCACAGCAGCGCCAATGTGGCGGAAGCCG 180

                           || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TA-CGCTACTCGGAGAAGTCACGCACAAAGTGCATTGGCATCACCATAGAAACAAGGCCA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GATTACTGCCTAAAGCGGCACATATCGGATATGCTTAGCTATGGTTGCACCCGGCTGGAA 300

                           ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| silico     301 ATCGGTGTGCAATCGGTTTACGA-AGACGTGGCCAGGGATACGAACCGCGGACACACGGT 360

                           ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| silico     361 GCGAGCGGTGTGCGAGAGCTTCCAGCTGGGCAAGGATGCTGGCTATAAGATCGTGACGCA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CATGATGCCTGATCTTCCCAATGTTGACTTTGAACGCGACATCGAGCAGTTTATCGAGTA 480

15433R-2.IR_full       481 CTTTGAGAACCCTGCCTTCCGCT 503
                           ||||||||||||||||||||||| silico     481 CTTTGAGAACCCTGCCTTCCGCT 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134990.2  CG15433-RA (CG15433), mRNA 
0   NM_136192.2  CG2508-RA (cdc23), mRNA 
0   NM_165331.2  CG31687-RA (CG31687), mRNA 
0   NM_134495.2  CG12234-RA (Ranbp21), mRNA 
0   NM_169972.1  CG31336-RA (Gr93b), mRNA 
0   NM_169870.1  CG6184-RB, transcript variant B (CG6184), mRNA 
0   NM_142567.1  CG6184-RA, transcript variant A (CG6184), mRNA 
0   NM_169871.1  CG6184-RC, transcript variant C (CG6184), mRNA 
0   NM_134927.1  CG15412-RA (CG15412), mRNA 
0   NM_134504.2  CG14232-RA (CG14232), mRNA 
0   NM_057214.3  CG4807-RA, transcript variant A (ab), mRNA 
0   NM_057215.3  CG4807-RB, transcript variant B (ab), mRNA 
0   NM_176458.2  CG4509-RB (CG4509), mRNA 
0   NM_137944.2  CG9891-RA (yellow-d2), mRNA 
0   NM_141932.2  CG11466-RA, transcript variant A (Cyp9f2), mRNA 
0   NM_206478.1  CG11466-RB, transcript variant B (Cyp9f2), mRNA 
0   NM_079647.2  CG8884-RF, transcript variant F (Sap47), mRNA 
0   NM_169690.1  CG8884-RB, transcript variant B (Sap47), mRNA 
0   NM_169685.1  CG8884-RC, transcript variant C (Sap47), mRNA 
0   NM_169689.1  CG8884-RG, transcript variant G (Sap47), mRNA 
0   NM_169687.1  CG8884-RE, transcript variant E (Sap47), mRNA 
0   NM_169686.1  CG8884-RD, transcript variant D (Sap47), mRNA 
0   NM_169684.1  CG8884-RA, transcript variant A (Sap47), mRNA 
0   NM_169688.1  CG8884-RH, transcript variant H (Sap47), mRNA 
0   NM_166934.1  CG3191-RA (CG3191), mRNA 
0   NM_143153.2  CG4719-RA (tankyrase), mRNA 
0   NM_057632.3  CG10072-RA (sgl), mRNA 
0   NM_136774.1  CG12325-RA (CG12325), mRNA 
0   NM_138984.2  CG5712-RA (ACXD), mRNA 
0   NM_168126.1  CG5406-RB, transcript variant B (sif), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.