National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1539R-1 
 Symbol tmod  Full Name tropomodulin 
 CG No CG1539  Old CG No CG1539 
 Synonyms l(3)S130910, CG1539, spdo, Tmod, l(3)00848, E42, 1309/10, 0970/02, unnamed, CG15540, CG11493, tmod, tropomodulin, Tropomodulin 
 Accession No (Link to NCBI) NM_057683.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Molnár I, Migh E, Szikora S, Kalmár T, Végh AG, Deák F, Barkó S, Bugyi B, Orfanos Z, Kovács J, Juhász G, Váró G, Nyitrai M, Sparrow J, Mihály J.
DAAM is required for thin filament formation and Sarcomerogenesis during muscle development in Drosophila.
PLoS Genet. (2014) 10(2) e1004166 [ PubMed ID = 24586196 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGTATGGCAAGGATCTGAGT 
 Primer Seq. 3'
aatctagaggtaccTTCGTAATGCCATCCCATCCC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTGTATGGCA AGGATCTGAG TGAGTACGAT GATGTGGATG TGGAGAGCCT GCTGGCCCAG 
0061 CTCTCCCCCG AGGAGATAAC CATACTGGCC AAAGAAGTGG ATCCCGATGA CAACTTCCTG 
0121 CCGCCAGACC AGCGCAATAG CCTATGAATG CACCAAGGAA GCCACCGGGC CTCTCAATCG 
0181 CAAGCAGCTG ATCGAGCACA TCAATAAGCA GGCCATCGAG ACCCCGGATC AGCCGGAGTT 
0241 CGAGCCGTTC GTTCAGGGCA AAGTTCGTGG AAAGAAGTGG GTCCCACCGC CAAGGGATGC 
0301 CCGCGACATC GAGGCCGAAG AACAAATCGC CATTGATATG GGCGAGGAGT ACGAACACGC 
0361 CCTTAACGAT GCCACGCAGG AGGAGATCAT CGATCTGGCC GCCATCCTCG GCTTCCACTC 
0421 GATGATGAAT CAGGACCAGT ACCACGCCTC CTTGCTCAAC AAGGGTCAgN CCGTGGGCCT 
0481 GGGATGGGAT GGCATTACGA A 
 in silico PCR Fragment
0001 CTGTATGGCA AGGATCTGAG TGAGTACGAT GATGTGGATG TGGAGAGCCT GCTGGCCCAG 
0061 CTCTCCCCCG AGGAGATAAC CATACTGGCC AAAGAAGTGG ATCCCGATGA CAACTTCCTG 
0121 CCGCCAGACC AGCGCAATAG -CTATGAGTG CACCAAGGAA GCCACCGGGC CTCTCAATCG 
0181 CAAGCAGCTG ATCGAGCACA TCAATAAGCA GGCCATCGAG ACCCCGGATC AGCCGGAGTT 
0241 CGAGCCGTTC GTTCAGGGCA AGGTTCGTGG AAAGAAGTGG GTCCCACCGC CAAGGGATGC 
0301 CCGCGACATC GAGGCCGAAG AACAAATCGC CATTGACATG GGCGAGGAGT ACGAACACGC 
0361 CCTTAACGAT GCCACGCAGG AGGAGATCAT CGATCTGGCC GCCATCCTCG GCTTCCACTC 
0421 GATGATGAAT CAGGACCAGT ACCACGCCTC CTTGCTCAAC AAGGGTCAGC CCGTGGGCCT 
0481 GGGATGGGAT GGCATTACGA A 
 Assemble Data

1539R-1.IR_full       1   CTGTATGGCAAGGATCTGAGTGAGTACGATGATGTGGATGTGGAGAGCCTGCTGGCCCAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1539R-1.in silico     1   CTGTATGGCAAGGATCTGAGTGAGTACGATGATGTGGATGTGGAGAGCCTGCTGGCCCAG 60


1539R-1.IR_full       61  CTCTCCCCCGAGGAGATAACCATACTGGCCAAAGAAGTGGATCCCGATGACAACTTCCTG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1539R-1.in silico     61  CTCTCCCCCGAGGAGATAACCATACTGGCCAAAGAAGTGGATCCCGATGACAACTTCCTG 120


1539R-1.IR_full       121 CCGCCAGACCAGCGCAATAGCCTATGAATGCACCAAGGAAGCCACCGGGCCTCTCAATCG 180
                          |||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||
1539R-1.in silico     121 CCGCCAGACCAGCGCAATAG-CTATGAGTGCACCAAGGAAGCCACCGGGCCTCTCAATCG 180


1539R-1.IR_full       181 CAAGCAGCTGATCGAGCACATCAATAAGCAGGCCATCGAGACCCCGGATCAGCCGGAGTT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1539R-1.in silico     181 CAAGCAGCTGATCGAGCACATCAATAAGCAGGCCATCGAGACCCCGGATCAGCCGGAGTT 240


1539R-1.IR_full       241 CGAGCCGTTCGTTCAGGGCAAAGTTCGTGGAAAGAAGTGGGTCCCACCGCCAAGGGATGC 300
                          ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||
1539R-1.in silico     241 CGAGCCGTTCGTTCAGGGCAAGGTTCGTGGAAAGAAGTGGGTCCCACCGCCAAGGGATGC 300


1539R-1.IR_full       301 CCGCGACATCGAGGCCGAAGAACAAATCGCCATTGATATGGGCGAGGAGTACGAACACGC 360
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
1539R-1.in silico     301 CCGCGACATCGAGGCCGAAGAACAAATCGCCATTGACATGGGCGAGGAGTACGAACACGC 360


1539R-1.IR_full       361 CCTTAACGATGCCACGCAGGAGGAGATCATCGATCTGGCCGCCATCCTCGGCTTCCACTC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1539R-1.in silico     361 CCTTAACGATGCCACGCAGGAGGAGATCATCGATCTGGCCGCCATCCTCGGCTTCCACTC 420


1539R-1.IR_full       421 GATGATGAATCAGGACCAGTACCACGCCTCCTTGCTCAACAAGGGTCAGNCCGTGGGCCT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
1539R-1.in silico     421 GATGATGAATCAGGACCAGTACCACGCCTCCTTGCTCAACAAGGGTCAGCCCGTGGGCCT 480


1539R-1.IR_full       481 GGGATGGGATGGCATTACGAA 501
                          |||||||||||||||||||||
1539R-1.in silico     481 GGGATGGGATGGCATTACGAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_170504.1  CG1539-RE, transcript variant E (tmod), mRNA 
100   482  NM_170503.1  CG1539-RD, transcript variant D (tmod), mRNA 
100   482  NM_170505.1  CG1539-RF, transcript variant F (tmod), mRNA 
100   482  NM_170506.1  CG1539-RC, transcript variant C (tmod), mRNA 
100   482  NM_057683.2  CG1539-RA, transcript variant A (tmod), mRNA 
100   482  NM_057684.2  CG1539-RB, transcript variant B (tmod), mRNA 
0.2   NM_139966.2  CG18543-RA (mtrm), mRNA 
0   NM_132159.1  CG1677-RA (CG1677), mRNA 
0   NM_139778.2  CG10274-RA (CG10274), mRNA 
0   NM_139588.3  CG12605-RB, transcript variant B (CG12605), mRNA 
0   NM_206275.2  CG12605-RA, transcript variant A (CG12605), mRNA 
0   NM_001014543.1  CG6741-RC, transcript variant C (a), mRNA 
0   NM_166514.1  CG6741-RA, transcript variant A (a), mRNA 
0   NM_079902.2  CG6741-RB, transcript variant B (a), mRNA 
0   14  NM_168898.1  CG32436-RA (CG32436), mRNA 
0   NM_132483.2  CG1737-RA (CG1737), mRNA 
0   NM_079258.2  CG5939-RA, transcript variant A (Prm), mRNA 
0   NM_168290.1  CG5939-RB, transcript variant B (Prm), mRNA 
0   NM_206430.1  CG2666-RC, transcript variant C (kkv), mRNA 
0   NM_169052.1  CG2666-RB, transcript variant B (kkv), mRNA 
0   NM_079509.1  CG2666-RA, transcript variant A (kkv), mRNA 
0   NM_132956.1  CG9086-RA (CG9086), mRNA 
0   NM_132759.1  CG9503-RA (CG9503), mRNA 
0   NM_135176.2  CG9506-RA (slam), mRNA 
0   NM_168291.1  CG5939-RC, transcript variant C (Prm), mRNA 
0   NM_168292.1  CG5939-RD, transcript variant D (Prm), mRNA 
0   NM_136050.2  CG31751-RB, transcript variant B (CG31751), mRNA 
0   NM_165260.1  CG31751-RA, transcript variant A (CG31751), mRNA 
0   NM_057732.3  CG8203-RA (Cdk5), mRNA 
0   NM_168879.2  CG9936-RC, transcript variant C (skd), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
++ 
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.