National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15342R-2 
 Symbol sdt  Full Name stardust 
 CG No CG32717  Old CG No CG15342 
 Synonyms PALS1, Std, CG15341, CG15339, std, anon-EST:fe2E6, l(1)7Ef, CG1617, CG15340, CG12658, CG15342, CG32717, sdt, stardust, anon-fast-evolving-2E6, pal1, Sdt 
 Accession No (Link to NCBI) NM_206652.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Hochapfel F, Denk L, Mendl G, Schulze U, Maaßen C, Zaytseva Y, Pavenstädt H, Weide T, Rachel R, Witzgall R, Krahn MP.
Distinct functions of Crumbs regulating slit diaphragms and endocytosis in Drosophila nephrocytes.
Cell. Mol. Life Sci. (2017) 74(24) 4573-4586 [ PubMed ID = 28717874 ] [ RRC reference ]

Wang H, Qiu Z, Xu Z, Chen SJ, Luo J, Wang X, Chen J.
aPKC is a key polarity determinant in coordinating the function of three distinct cell polarities during collective migration.
Development (2018) 145(9) [ PubMed ID = 29636381 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTCGTGTCCACTTTGCACATA 
 Primer Seq. 3'
aatctagaggtaccTTGACTTGCCTGTTGTTGTCG 
 Predicted Fragment Size
412 
 IR fragment full Seq
0001 GTCGTGTCCA CTTTGCACAT AACGCTGGAG AACAACGGCA ATGTTGCTGC GGGGCCAGCC 
0061 TGCTGCCGTT GCTGTCCTGC CAGTAGTACG TTGGGGCAGC AACATCGCCG ACCAAGTTTG 
0121 CCGTGCTGTC GGCGCAGCAG CTGCAACTGC AACTGCAGCA GCAGCAGCAG CAGCAGAACG 
0181 AAAAGGAGAA CCATATGAAC AATAATAACA ATAACAGCGA CTATTGTGAT ATGAATGGCA 
0241 ATGGAGTTGG AATGGGAAAC GGTGGTAGTG GTGGACCGGG ATCTCTGACC CCCCAATCCC 
0301 CCGACCAATA TGTCGGCTCA CCTGTATCAT CCGCTGCCAC GCCCCATGCG CATCCGCCTC 
0361 CGCCCTGCGT CGCGGCATTC AAATTCAACG ATCCTCGACG CGTTTGCGAC AACAACAGG 
 in silico PCR Fragment
0001 GTCGTGTCCA CTTTGCACAT AACGCTGGAG AACAACGGCA ATGTTGCTGC GGGG-CAGCC 
0061 TGCTGCCGTT GCTG--CTGC CAGT-GT-CG TTGGGGCAGC AACATCGCCG ACCAAGTTTG 
0121 CCGTGCTGTC GGCGCAGCAG CTGCAACTGC AACTGCAGCA GCAGCAGCAG CAGCAGAACG 
0181 AAAAGGAGAA CCATATGAAC AATAATAACA ATAACAGCGA CTATTGTGAT ATGAATGGCA 
0241 ATGGAGTTGG AATGGGAAAC GGTGGTAGTG GTGGACCGGG ATCTCTGACC CCCCAATCCC 
0301 CCGACCAATA TGTCGGCTCA CCTGTATCAT CCGCTGCCAC GCCCCA-GCG CA-CCGCCTC 
0361 CGCCCTGCGT CGCGGCATTC AAATTCAACG ATCCTCGACG CGTTTGCGAC AACAACAGG 
 Assemble Data

15342R-2.IR_full       1   GTCGTGTCCACTTTGCACATAACGCTGGAGAACAACGGCAATGTTGCTGCGGGGCCAGCC 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
15342R-2.in silico     1   GTCGTGTCCACTTTGCACATAACGCTGGAGAACAACGGCAATGTTGCTGCGGGG-CAGCC 60


15342R-2.IR_full       61  TGCTGCCGTTGCTGTCCTGCCAGTAGTACGTTGGGGCAGCAACATCGCCGACCAAGTTTG 120
                           ||||||||||||||  |||||||| || ||||||||||||||||||||||||||||||||
15342R-2.in silico     61  TGCTGCCGTTGCTG--CTGCCAGT-GT-CGTTGGGGCAGCAACATCGCCGACCAAGTTTG 120


15342R-2.IR_full       121 CCGTGCTGTCGGCGCAGCAGCTGCAACTGCAACTGCAGCAGCAGCAGCAGCAGCAGAACG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15342R-2.in silico     121 CCGTGCTGTCGGCGCAGCAGCTGCAACTGCAACTGCAGCAGCAGCAGCAGCAGCAGAACG 180


15342R-2.IR_full       181 AAAAGGAGAACCATATGAACAATAATAACAATAACAGCGACTATTGTGATATGAATGGCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15342R-2.in silico     181 AAAAGGAGAACCATATGAACAATAATAACAATAACAGCGACTATTGTGATATGAATGGCA 240


15342R-2.IR_full       241 ATGGAGTTGGAATGGGAAACGGTGGTAGTGGTGGACCGGGATCTCTGACCCCCCAATCCC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15342R-2.in silico     241 ATGGAGTTGGAATGGGAAACGGTGGTAGTGGTGGACCGGGATCTCTGACCCCCCAATCCC 300


15342R-2.IR_full       301 CCGACCAATATGTCGGCTCACCTGTATCATCCGCTGCCACGCCCCATGCGCATCCGCCTC 360
                           |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||
15342R-2.in silico     301 CCGACCAATATGTCGGCTCACCTGTATCATCCGCTGCCACGCCCCA-GCGCA-CCGCCTC 360


15342R-2.IR_full       361 CGCCCTGCGTCGCGGCATTCAAATTCAACGATCCTCGACGCGTTTGCGACAACAACAGG 419
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15342R-2.in silico     361 CGCCCTGCGTCGCGGCATTCAAATTCAACGATCCTCGACGCGTTTGCGACAACAACAGG 419

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.