National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15319R-2 
 Symbol nej  Full Name nejire 
 CG No CG15319  Old CG No CG15319 
 Synonyms CBP, nej CBP, dCBP, dmCBP, CG15319, CBP/p300, anon-WO0147981.11, p300/CBP, cbp, Cbp, CBP_, Crbp, anon-WO03040301.89, nej 
 Accession No (Link to NCBI) NM_079903.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Bodai L, Zsindely N, Gáspár R, Kristó I, Komonyi O, Boros IM.
Ecdysone induced gene expression is associated with acetylation of histone H3 lysine 23 in Drosophila melanogaster.
PLoS ONE (2012) 7(7) e40565 [ PubMed ID = 22808194 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCTGGAGGAGAACCTGCCCGA 
 Primer Seq. 3'
aatctagaggtaccTCTGAGTGCCCACCACCTGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCTGGAGGAG AACCTGCCCG ATGAGCTGGT GTCCTCGAAT AGTGGCTGGT CGGATCAGCT 
0061 GACCGGCgGA GCAAGGGCGG TGGCAATGGA GGTGGCGGCG cCTCCGGTGT AACCACAAAT 
0121 CCCACATCCG GCCCAAATCC CGGTGGCGGA CCCAACAAGC CGGCAGCCCA AGGACCCGGC 
0181 TCTGGCACAG GCGGAGTCGG TGTTGGAGTG AATGTGGGTG TCGGCAGTGT TGTTGGCGTC 
0241 GGCGTTGTGC CTTCCCAGAT GAACGGAGCC GGCGGCGGCA ACGGATCCGG AACGGGTGGC 
0301 GACGACGGCA GTGGCAACGG CTCAGGAGCG GGCAACAGAA TCAGTCAAAT GCAACACCAG 
0361 CAACTGCAGC ACCTACTCCA GCAGCAGCAG CAGGGCCAGA AGGGCGCCAT GGTGGTGCCC 
0421 GGCATGCAgC AGCTGGGCAG CAAGTCGCCC AACCTGCAGT CACCCAACCA GGGCGGCATG 
0481 CAGCAGGTGG TGGGCACTCA GA 
 in silico PCR Fragment
0001 TCTGGAGGAG AACCTGCCCG ATGAGCTGGT GTCCTCGAAT AGTGGCTGGT CGGATCAGCT 
0061 GACCGGCGGA GCA--GGCGG TGGCAATGGA GGTGGCGGCG CCTCCGGTGT AACCACAAAT 
0121 CCCACATCCG GCCCAAATCC CGGTGGCGGA CCCAACAAGC CGGCAGCCCA AGGACCCGGC 
0181 TCTGGCACAG GCGGAGTCGG TGTTGGAGTG AATGTGGGTG TCGGCGGTGT TGTTGGCGTC 
0241 GGCGTTGTGC CTTCCCAGAT GAACGGAGCC GGCGGCGGCA ACGGATCCGG AACGGGTGGC 
0301 GACGACGGCA GTGGCAACGG CTCAGGAGCG GGCAACAGAA TCAGTCAAAT GCAACACCAG 
0361 CAACTGCAGC ACCTACTCCA GCAGCAGCAG CAGGGCCAGA AGGGCGCCAT GGTGGTGCCC 
0421 GGCATGCAGC AGCTGGGCAG CAAGTCGCCC AACCTGCAGT CACCCAACCA GGGCGGCATG 
0481 CAGCAGGTGG TGGGCACTCA GA 
 Assemble Data

15319R-2.IR_full       1   TCTGGAGGAGAACCTGCCCGATGAGCTGGTGTCCTCGAATAGTGGCTGGTCGGATCAGCT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15319R-2.in silico     1   TCTGGAGGAGAACCTGCCCGATGAGCTGGTGTCCTCGAATAGTGGCTGGTCGGATCAGCT 60


15319R-2.IR_full       61  GACCGGCGGAGCAAGGGCGGTGGCAATGGAGGTGGCGGCGCCTCCGGTGTAACCACAAAT 120
                           |||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||
15319R-2.in silico     61  GACCGGCGGAGCA--GGCGGTGGCAATGGAGGTGGCGGCGCCTCCGGTGTAACCACAAAT 120


15319R-2.IR_full       121 CCCACATCCGGCCCAAATCCCGGTGGCGGACCCAACAAGCCGGCAGCCCAAGGACCCGGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15319R-2.in silico     121 CCCACATCCGGCCCAAATCCCGGTGGCGGACCCAACAAGCCGGCAGCCCAAGGACCCGGC 180


15319R-2.IR_full       181 TCTGGCACAGGCGGAGTCGGTGTTGGAGTGAATGTGGGTGTCGGCAGTGTTGTTGGCGTC 240
                           ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
15319R-2.in silico     181 TCTGGCACAGGCGGAGTCGGTGTTGGAGTGAATGTGGGTGTCGGCGGTGTTGTTGGCGTC 240


15319R-2.IR_full       241 GGCGTTGTGCCTTCCCAGATGAACGGAGCCGGCGGCGGCAACGGATCCGGAACGGGTGGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15319R-2.in silico     241 GGCGTTGTGCCTTCCCAGATGAACGGAGCCGGCGGCGGCAACGGATCCGGAACGGGTGGC 300


15319R-2.IR_full       301 GACGACGGCAGTGGCAACGGCTCAGGAGCGGGCAACAGAATCAGTCAAATGCAACACCAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15319R-2.in silico     301 GACGACGGCAGTGGCAACGGCTCAGGAGCGGGCAACAGAATCAGTCAAATGCAACACCAG 360


15319R-2.IR_full       361 CAACTGCAGCACCTACTCCAGCAGCAGCAGCAGGGCCAGAAGGGCGCCATGGTGGTGCCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15319R-2.in silico     361 CAACTGCAGCACCTACTCCAGCAGCAGCAGCAGGGCCAGAAGGGCGCCATGGTGGTGCCC 420


15319R-2.IR_full       421 GGCATGCAGCAGCTGGGCAGCAAGTCGCCCAACCTGCAGTCACCCAACCAGGGCGGCATG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15319R-2.in silico     421 GGCATGCAGCAGCTGGGCAGCAAGTCGCCCAACCTGCAGTCACCCAACCAGGGCGGCATG 480


15319R-2.IR_full       481 CAGCAGGTGGTGGGCACTCAGA 502
                           ||||||||||||||||||||||
15319R-2.in silico     481 CAGCAGGTGGTGGGCACTCAGA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  36  222  NM_079903.2  CG15319-RB (nej), mRNA 
0.62   19  111  NM_132246.2  CG10555-RA (CG10555), mRNA 
0.62   49  NM_168102.1  CG32239-RA (Gef64C), mRNA 
0.41   NM_135238.2  CG10354-RA (CG10354), mRNA 
0.41   33  NM_132115.1  CG14440-RA (CG14440), mRNA 
0.2   NM_130550.2  CG11417-RA (CG11417), mRNA 
0.2   11  70  NM_135793.2  CG16970-RA (CG16970), mRNA 
0.2   NM_143254.2  CG5500-RA (CG5500), mRNA 
0.2   22  NM_140735.1  CG6311-RB (CG6311), mRNA 
0.2   63  537  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0.2   63  537  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0.2   63  537  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0.2   10  28  NM_057385.4  CG11121-RA (so), mRNA 
0.2   14  NM_176579.1  CG33203-RC (CG33203), mRNA 
0.2   33  NM_166961.1  CG32498-RI, transcript variant I (dnc), mRNA 
0.2   33  NM_166965.1  CG32498-RJ, transcript variant J (dnc), mRNA 
0.2   33  NM_166963.1  CG32498-RK, transcript variant K (dnc), mRNA 
0.2   33  NM_166964.1  CG32498-RD, transcript variant D (dnc), mRNA 
0.2   33  NM_166962.1  CG32498-RC, transcript variant C (dnc), mRNA 
0.2   19  NM_138210.1  CG13894-RA (CG13894), mRNA 
0.2   15  NM_206151.1  CG6542-RB, transcript variant B (EDTP), mRNA 
0.2   15  NM_079046.2  CG6542-RA, transcript variant A (EDTP), mRNA 
0   32  NM_079149.3  CG17046-RA, transcript variant A (klar), mRNA 
0   29  NM_001043111.1  CG17046-RB, transcript variant B (klar), mRNA 
0   13  66  NM_164858.1  CG4405-RB, transcript variant B (jp), mRNA 
0   13  66  NM_078801.4  CG4405-RA, transcript variant A (jp), mRNA 
0   10  NM_164715.1  CG32828-RA (CG32828), mRNA 
0   NM_170379.2  CG31048-RA (CG31048), mRNA 
0   23  75  NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 
0   23  75  NM_130717.3  CG32782-RC, transcript variant C (tlk), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.