National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1519R-2 
 Symbol Prosalpha7  Full Name Proteasome alpha7 subunit 
 CG No CG1519  Old CG No CG1519 
 Synonyms alpha7, Prosalpha7, alpha7_dm, CG1519 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Jia D, Soylemez M, Calvin G, Bornmann R, Bryant J, Hanna C, Huang YC, Deng WM.
A large-scale in vivo RNAi screen to identify genes involved in Notch-mediated follicle cell differentiation and cell cycle switches.
Sci Rep (2015) 5 12328 [ PubMed ID = 26205122 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTACTATTGGCACTGGATACG 
 Primer Seq. 3'
aatctagaggtaccAGGCGAAGTAACCGAAGGAGG 
 Predicted Fragment Size
486 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

1519R-2.IR full        1   TTCTATTGGCACTGGATACGACTTGTCGGCCTCGCAGTTTTCGCCTGATGGCCGCGTTT 59
                           | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1519R-2.in silico      1   TACTATTGGCACTGGATACGACTTGTCGGCCTCGCAGTTTTCGCCTGATGGCCGCGTTT 59


1519R-2.IR full       61  TCCAGATCGACTACNCCTCAAAGGCGGTGGAGAAGAGCGGCACCGTAATCGGGATTCGGG 119
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
1519R-2.in silico     61  TCCAGATCGACTACGCCTCAAAGGCGGTGGAGAAGAGCGGCACCGTAATCGGGATTCGGG 119


1519R-2.IR full       121 GCAAGGACGCCGTGGTGCTGGCCGTGGAGAAGATCATCACCAGTAAACTGTACGAACCAG 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1519R-2.in silico     121 GCAAGGACGCCGTGGTGCTGGCCGTGGAGAAGATCATCACCAGTAAACTGTACGAACCAG 179


1519R-2.IR full       181 ACGCCGGCGGACGCATCTTCACCATCGAAAAGAACATCGGAATGGCGGTGGCCGGCTTGG 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1519R-2.in silico     181 ACGCCGGCGGACGCATCTTCACCATCGAAAAGAACATCGGAATGGCGGTGGCCGGCTTGG 239


1519R-2.IR full       241 TGGCCGATGGAAACTTTGTGGCTGACATTGCGCGTCAGGAGGCAGCCAACTACAGACAGC 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1519R-2.in silico     241 TGGCCGATGGAAACTTTGTGGCTGACATTGCGCGTCAGGAGGCAGCCAACTACAGACAGC 299


1519R-2.IR full       301 AATTTGAGCAGGCTATCCCGCTTAAACACCTGTGCCACCGAGTCGCCGGCTACGTTCACG 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1519R-2.in silico     301 AATTTGAGCAGGCTATCCCGCTTAAACACCTGTGCCACCGAGTCGCCGGCTACGTTCACG 359


1519R-2.IR full       361 CCTACACTCTGTACAGTGCCGTCCGCCCCTTCGGACTTTCCATCATTCTCGCCTCCTGGG 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1519R-2.in silico     361 CCTACACTCTGTACAGTGCCGTCCGCCCCTTCGGACTTTCCATCATTCTCGCCTCCTGGG 419


1519R-2.IR full       421 ACGAAGTAGAGGG-CCACAGCTCTACAAGATCGAGNCGTCCGGCTCCTCCTTCGGTTACT 479
                          ||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||
1519R-2.in silico     421 ACGAAGTAGAGGGGCCACAGCTCTACAAGATCGAGCCGTCCGGCTCCTCCTTCGGTTACT 479


1519R-2.IR full       481 TCGCCT 485
                          ||||||
1519R-2.in silico     481 TCGCCT 485

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
++ 
VB
++ 
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
++ 
VB
++ 
Dcompartment   Penetrance
++     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.