National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15015R-3 
 Symbol Cip4  Full Name Cip4 
 CG No CG15015  Old CG No CG15015 
 Synonyms CG15015, DCIP4, CG11341, Cip4, cip4 
 Accession No (Link to NCBI) NM_139636.2 
 Inserted Chr. ll 
 Insertional Mutation  3 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Leibfried A, Fricke R, Morgan MJ, Bogdan S, Bellaiche Y.
Drosophila Cip4 and WASp define a branch of the Cdc42-Par6-aPKC pathway regulating E-cadherin endocytosis.
Curr. Biol. (2008) 18(21) 1639-48 [ PubMed ID = 18976911 ] [ RRC reference ]

Nahm M, Kim S, Paik SK, Lee M, Lee S, Lee ZH, Kim J, Lee D, Bae YC, Lee S.
dCIP4 (Drosophila Cdc42-interacting protein 4) restrains synaptic growth by inhibiting the secretion of the retrograde Glass bottom boat signal.
J. Neurosci. (2010) 30(24) 8138-50 [ PubMed ID = 20554864 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACAGATTCACATCGGTGCAAG 
 Primer Seq. 3'
aatctagaggtaccAATGAACTCCCTGAAGCCACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGAATTCAC ATCGGTGCAA GCGTTCCNCA ATCTGCTCAA GGAGGTGGGC GATCTGGCGG 
0061 GACAGCGCGA GGTGGTGTCC GAGTACCCTG CAGCTGCAGA TCATTGCGGG AGTGACGCTT 
0121 CTGTCCAAGA CATTGCGCGA GGAACGCAAG AAATGCCTTA GCGATGGTGC CACCCTGCAG 
0181 CAGAACCTCA CCACACAGCT CTCCTCGCTG GACCGGGCCA AGCGGAACTA CGAGAAGGCC 
0241 TACCGTGACT CGGAGAAGGC GGTGGACAGC TATAAGCGGG CAGACATGGA CCTCAATCTC 
0301 AGCCGGGCCG AGGTGGAGCG CTACAAGAAC GTGATGACGT CCAAGATCCA GCAGTCGGAC 
0361 GATGCGAAGA ACGAGTACGC TAACCAGCTA CAGAAGACGA ACAATCTGCA GCAGCAACAC 
0421 TACAGCATGC TGCTGCCCTC GGTCCTCAAT CGGCTGCAGG AGCTGGACGA GAAACGCACC 
0481 CGTGGCTTCA GGGAGTTCAT T 
 in silico PCR Fragment
0001 ATGAATTCAC ATCGGTGCAA GCGTTCCGCA ATCTGCTCAA GGAGGTGGGC GATCTGGCGG 
0061 GACAGCGCGA GGTGGTGTCC GAGT-CCCTG CAGCTGCAGA TCATTGCGGG AGTGACGCTT 
0121 CTGTCCAAGA CATTGCGCGA GGAACGCAAG AAATGCCTTA GCGATGGTGC CACCCTGCAG 
0181 CAGAACCTCA CCACACAGCT CTCCTCGCTG GACCGGGCCA AGCGGAACTA CGAGAAGGCC 
0241 TACCGTGACT CGGAGAAGGC GGTGGACAGC TATAAGCGGG CAGACATGGA CCTCAATCTC 
0301 AGCCGGGCCG AGGTGGAGCG CTACAAGAAC GTGATGACGT CCAAGATCCA GCAGTCGGAC 
0361 GATGCGAAGA ACGAGTACGC TAACCAGCTA CAGAAGACGA ACAATCTGCA GCAGCAACAC 
0421 TACAGCATGC TGCTGCCCTC GGTCCTCAAT CGGCTGCAGG AGCTGGACGA GAAACGCACC 
0481 CGTGGCTTCA GGGAGTTCAT T 
 Assemble Data

15015R-3.IR_full       1   ATGAATTCACATCGGTGCAAGCGTTCCNCAATCTGCTCAAGGAGGTGGGCGATCTGGCGG 60
                           ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
15015R-3.in silico     1   ATGAATTCACATCGGTGCAAGCGTTCCGCAATCTGCTCAAGGAGGTGGGCGATCTGGCGG 60


15015R-3.IR_full       61  GACAGCGCGAGGTGGTGTCCGAGTACCCTGCAGCTGCAGATCATTGCGGGAGTGACGCTT 120
                           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
15015R-3.in silico     61  GACAGCGCGAGGTGGTGTCCGAGT-CCCTGCAGCTGCAGATCATTGCGGGAGTGACGCTT 120


15015R-3.IR_full       121 CTGTCCAAGACATTGCGCGAGGAACGCAAGAAATGCCTTAGCGATGGTGCCACCCTGCAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15015R-3.in silico     121 CTGTCCAAGACATTGCGCGAGGAACGCAAGAAATGCCTTAGCGATGGTGCCACCCTGCAG 180


15015R-3.IR_full       181 CAGAACCTCACCACACAGCTCTCCTCGCTGGACCGGGCCAAGCGGAACTACGAGAAGGCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15015R-3.in silico     181 CAGAACCTCACCACACAGCTCTCCTCGCTGGACCGGGCCAAGCGGAACTACGAGAAGGCC 240


15015R-3.IR_full       241 TACCGTGACTCGGAGAAGGCGGTGGACAGCTATAAGCGGGCAGACATGGACCTCAATCTC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15015R-3.in silico     241 TACCGTGACTCGGAGAAGGCGGTGGACAGCTATAAGCGGGCAGACATGGACCTCAATCTC 300


15015R-3.IR_full       301 AGCCGGGCCGAGGTGGAGCGCTACAAGAACGTGATGACGTCCAAGATCCAGCAGTCGGAC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15015R-3.in silico     301 AGCCGGGCCGAGGTGGAGCGCTACAAGAACGTGATGACGTCCAAGATCCAGCAGTCGGAC 360


15015R-3.IR_full       361 GATGCGAAGAACGAGTACGCTAACCAGCTACAGAAGACGAACAATCTGCAGCAGCAACAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15015R-3.in silico     361 GATGCGAAGAACGAGTACGCTAACCAGCTACAGAAGACGAACAATCTGCAGCAGCAACAC 420


15015R-3.IR_full       421 TACAGCATGCTGCTGCCCTCGGTCCTCAATCGGCTGCAGGAGCTGGACGAGAAACGCACC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15015R-3.in silico     421 TACAGCATGCTGCTGCCCTCGGTCCTCAATCGGCTGCAGGAGCTGGACGAGAAACGCACC 480


15015R-3.IR_full       481 CGTGGCTTCAGGGAGTTCATT 501
                           |||||||||||||||||||||
15015R-3.in silico     481 CGTGGCTTCAGGGAGTTCATT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139636.2  CG15015-RA (Cip4), mRNA 
0.41   NM_170578.1  CG1971-RB, transcript variant B (CG1971), mRNA 
0.41   NM_143643.2  CG1971-RA, transcript variant A (CG1971), mRNA 
0.2   NM_167278.1  CG11759-RA (Kap3), mRNA 
0   NM_166999.2  CG32790-RA (CG32790), mRNA 
0   16  NM_145757.2  CG30084-RC, transcript variant C (CG30084), mRNA 
0   13  NM_137214.3  CG30084-RA, transcript variant A (CG30084), mRNA 
0   NM_001038883.1  CG33988-RA (CG33988), mRNA 
0   NM_166996.2  CG32776-RA, transcript variant A (CG32776), mRNA 
0   NM_001038741.1  CG32776-RC, transcript variant C (CG32776), mRNA 
0   NM_206622.2  CG32776-RB, transcript variant B (CG32776), mRNA 
0   NM_001038740.1  CG32776-RD, transcript variant D (CG32776), mRNA 
0   NM_079008.2  CG6315-RA, transcript variant A (fl(2)d), mRNA 
0   NM_166010.1  CG6315-RB, transcript variant B (fl(2)d), mRNA 
0   11  18  NM_139732.2  CG10542-RA (CG10542), mRNA 
0   12  NM_165836.1  CG7776-RB, transcript variant B (E(Pc)), mRNA 
0   12  NM_078974.2  CG7776-RA, transcript variant A (E(Pc)), mRNA 
0   NM_137624.1  CG9090-RA (CG9090), mRNA 
0   NM_167028.1  CG6775-RB, transcript variant B (rg), mRNA 
0   NM_080023.1  CG6775-RA, transcript variant A (rg), mRNA 
0   NM_001042796.1  CG6775-RC, transcript variant C (rg), mRNA 
0   NM_079733.3  CG4677-RA, transcript variant A (lmd), mRNA 
0   NM_170044.2  CG4677-RB, transcript variant B (lmd), mRNA 
0   NM_132089.3  CG3847-RA (CG3847), mRNA 
0   NM_057944.3  CG12249-RB, transcript variant B (mira), mRNA 
0   NM_057943.3  CG12249-RA, transcript variant A (mira), mRNA 
0   NM_140388.1  CG10713-RA (CG10713), mRNA 
0   16  NM_141542.1  CG11718-RA (CG11718), mRNA 
0   NM_140197.1  CG18490-RB, transcript variant B (CG18490), mRNA 
0   NM_168453.1  CG18490-RC, transcript variant C (CG18490), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.