National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 15006R-1 
 Symbol Cpr64Aa  Full Name Cuticular protein 64Aa 
 CG No CG15006  Old CG No CG15006 
 Synonyms Cpr64Aa, CG15006 
 Accession No (Link to NCBI) NM_139615.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Minami R, Sato C, Yamahama Y, Kubo H, Hariyama T, Kimura KI.
An RNAi Screen for Genes Involved in Nanoscale Protrusion Formation on Corneal Lens in Drosophila melanogaster.
Zool. Sci. (2016) 33(6) 583-591 [ PubMed ID = 27927092 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet. (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAACTGATCCTCGTCCTGAGCG 
 Primer Seq. 3'
aatctagaggtaccTTGGCCACCAGAGGAGAGGCA 
 Predicted Fragment Size
430 
 IR fragment full Seq
0001 AACTGATCCT CGTCCTGAGC GCCCTGGTGG cGGTGTCCTC CGCCGTTGTG GTCCCTGGTC 
0061 CCGGACTGGC ACTGCCCGCC TATCCATCGT ACCCGGCGCT GGCCAAGGTG GCTGCTCCTC 
0121 TGGTGGCCAA GGTGGCGGGT CCGGAGCCAT ACGATCCCAA TCCCCAATAC ACCTTCAGCT 
0181 ACGATGTTCA TGATGGCTCC ACTGGTGACG TGAAGAGCCA GCAGGAGACC CGCAGCGGAG 
0241 ATGTGGTGCA GGGCGCCTNA TTCACTGATT GAGGCCGACG GAACCCGCCG CATTGTGGAG 
0301 TACACCGCCG ATCCCGTGCA CGGATTCAAC GCAGTGGTGC GCCGCGAGGG AGCTGTGGTG 
0361 AAGGCTGTGG CTCCGGTGGC CAAGGTTCTG GCCCCGCCTC CGCTGCTCCA TGCCTCTCCT 
0421 CTGGTGGCCA A 
 in silico PCR Fragment
0001 AACTGATCCT CGTCCTGAGC GCCCTGGTGG CGGTGTCCTC CGCCGTTGTG GTCCCTGGTC 
0061 CCGGACTGGC ACTGCCCGCC TATCCATCGT ACCCGGCGCT GGCCAAGGTG GCTGCTCCTC 
0121 TGGTGGCCAA GGTGGCGGGT CCGGAGCCAT ACGATCCCAA TCCCCAATAC ACCTTCAGCT 
0181 ACGATGTTCA TGATGGCTCC ACTGGTGACG TGAAGAGCCA GCAGGAGACC CGCAGCGGAG 
0241 ATGTGGTGCA GGGCGCCT-A TTCACTGATT GAGGCCGACG GAACCCGCCG CATTGTGGAG 
0301 TACACCGCCG ATCCCGTGCA CGGATTCAAC GCAGTGGTGC GCCGCGAGGG AGCTGTGGTG 
0361 AAGGCTGTGG CTCCGGTGGC CAAGGTTCTG GCCCCGGCTC CGCTGCTCCA TGCCTCTCCT 
0421 CTGGTGGCCA A 
 Assemble Data

15006R-1.IR_full       1   AACTGATCCTCGTCCTGAGCGCCCTGGTGGCGGTGTCCTCCGCCGTTGTGGTCCCTGGTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15006R-1.in silico     1   AACTGATCCTCGTCCTGAGCGCCCTGGTGGCGGTGTCCTCCGCCGTTGTGGTCCCTGGTC 60


15006R-1.IR_full       61  CCGGACTGGCACTGCCCGCCTATCCATCGTACCCGGCGCTGGCCAAGGTGGCTGCTCCTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15006R-1.in silico     61  CCGGACTGGCACTGCCCGCCTATCCATCGTACCCGGCGCTGGCCAAGGTGGCTGCTCCTC 120


15006R-1.IR_full       121 TGGTGGCCAAGGTGGCGGGTCCGGAGCCATACGATCCCAATCCCCAATACACCTTCAGCT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15006R-1.in silico     121 TGGTGGCCAAGGTGGCGGGTCCGGAGCCATACGATCCCAATCCCCAATACACCTTCAGCT 180


15006R-1.IR_full       181 ACGATGTTCATGATGGCTCCACTGGTGACGTGAAGAGCCAGCAGGAGACCCGCAGCGGAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15006R-1.in silico     181 ACGATGTTCATGATGGCTCCACTGGTGACGTGAAGAGCCAGCAGGAGACCCGCAGCGGAG 240


15006R-1.IR_full       241 ATGTGGTGCAGGGCGCCTNATTCACTGATTGAGGCCGACGGAACCCGCCGCATTGTGGAG 300
                           |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||
15006R-1.in silico     241 ATGTGGTGCAGGGCGCCT-ATTCACTGATTGAGGCCGACGGAACCCGCCGCATTGTGGAG 300


15006R-1.IR_full       301 TACACCGCCGATCCCGTGCACGGATTCAACGCAGTGGTGCGCCGCGAGGGAGCTGTGGTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
15006R-1.in silico     301 TACACCGCCGATCCCGTGCACGGATTCAACGCAGTGGTGCGCCGCGAGGGAGCTGTGGTG 360


15006R-1.IR_full       361 AAGGCTGTGGCTCCGGTGGCCAAGGTTCTGGCCCCGCCTCCGCTGCTCCATGCCTCTCCT 420
                           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
15006R-1.in silico     361 AAGGCTGTGGCTCCGGTGGCCAAGGTTCTGGCCCCGGCTCCGCTGCTCCATGCCTCTCCT 420


15006R-1.IR_full       421 CTGGTGGCCAA 431
                           |||||||||||
15006R-1.in silico     421 CTGGTGGCCAA 431

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.48  414  14  NM_139615.2  CG15006-RA (CG15006), mRNA 
1.69   14  10  38  NM_141420.2  CG2342-RA (Ccp84Ag), mRNA 
0   11  NM_057558.3  CG16963-RA (Cry), mRNA 
0   NM_164877.1  CG31878-RB, transcript variant B (CG31878), mRNA 
0   NM_164878.1  CG31878-RA, transcript variant A (CG31878), mRNA 
0   12  NM_140864.1  CG9290-RA (CG9290), mRNA 
0   NM_139618.2  CG1259-RB (CG1259), mRNA 
0   NM_167522.2  CG4429-RB, transcript variant B (Rbp2), mRNA 
0   NM_080220.2  CG4429-RA, transcript variant A (Rbp2), mRNA 
0   NM_206764.1  CG4429-RC, transcript variant C (Rbp2), mRNA 
0   NM_206398.1  CG33255-RA (CG33255), mRNA 
0   11  18  NM_139617.1  CG15008-RA (CG15008), mRNA 
0   10  NM_168797.1  CG32213-RA (CG32213), mRNA 
0   10  NM_168796.1  CG32208-RA (825-Oak), mRNA 
0   NM_139411.1  CG1919-RA (CG1919), mRNA 
0   NM_079523.1  CG2345-RA (Edg84A), mRNA 
0   NM_165103.2  CG3506-RA (vas), mRNA 
0   NM_078768.2  CG9554-RB, transcript variant B (eya), mRNA 
0   NM_164693.1  CG9554-RA, transcript variant A (eya), mRNA 
0   NM_130571.1  CG14796-RA (CG14796), mRNA 
0   NM_164429.1  CG31666-RC, transcript variant C (CG31666), mRNA 
0   NM_164428.2  CG31666-RB, transcript variant B (CG31666), mRNA 
0   NM_134766.3  CG31666-RA, transcript variant A (CG31666), mRNA 
0   NM_164430.2  CG31666-RD, transcript variant D (CG31666), mRNA 
0   12  NM_140857.2  CG12519-RA (CG12519), mRNA 
0   10  35  NM_141423.2  CG2341-RA (Ccp84Ad), mRNA 
0   38  NM_141426.1  CG2360-RA (Ccp84Aa), mRNA 
0   32  NM_141425.1  CG1252-RA (Ccp84Ab), mRNA 
0   NM_168795.1  CG32214-RA (CG32214), mRNA 
0   27  NM_142556.2  CG6240-RA (CG6240), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.