National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14902R-2 
 Symbol decay  Full Name death executioner caspase related to Apopain/Yama 
 CG No CG14902  Old CG No CG14902 
 Synonyms caspase 3, Caspase-3, caspase-3, Decay, CG14902, Drosophila executioner caspase related to Apopain/Yama, DECAY, decay, Casp3 
 Accession No (Link to NCBI) NM_058114.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Khammari A, Agn├Ęs F, Gandille P, Pret AM.
Physiological apoptosis of polar cells during Drosophila oogenesis is mediated by Hid-dependent regulation of Diap1.
Cell Death Differ. (2011) 18(5) 793-805 [ PubMed ID = 21113144 ] [ RRC reference ]

Leulier F, Ribeiro PS, Palmer E, Tenev T, Takahashi K, Robertson D, Zachariou A, Pichaud F, Ueda R, Meier P.
Systematic in vivo RNAi analysis of putative components of the Drosophila cell death machinery.
Cell Death Differ. (2006) 13(10) 1663-74 [ PubMed ID = 16485033 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCAAGATCGCCCATACGCCC 
 Primer Seq. 3'
aatctagaggtaccGTCATCACAGCGAAGCTGGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCAAGATCG cCCATACGCC CACATCGGAG CTGGACCTCA AAAGGATCAT AATCTCGCGC 
0061 CCCACCAACG AGGACACATA CGANGAATTG CGCGCGAGCg GGNATNTGCG CTAATCCTGA 
0121 ACCACAAGGA TGTCAAGGGA CAGAAGCAGC GCGTGGGCAC CGAACGGGAT CGCGATGACA 
0181 TGGAGGCGAC GCTGCAGGGA TTCGGATTCG ATGTACGCAC CTTCGACGAT CTGACCTTCT 
0241 CCGAGATCAA CGACACGCTC AAAGAGGTTG CTCGCGAGGA TCACAGTCAA AACGACTGCT 
0301 TTGTGTTGGC GGTGATGTCA CACGGCACCG AAGGCAAGGT CTACGCTAAG GACATGTCAT 
0361 ATCCTGTGGA GCGCCTTTGG AATCCCTTCC TCGGCGACAA CTGCAAGACG CTCAAGAACA 
0421 AACCCAAACT CTTCTTCATC CAGGCCTGTC GNGGAGCCAA CCTGGAAAAG GCAGTCGAGT 
0481 TCTCCAGcTT CGCTGTGATG AC 
 in silico PCR Fragment
0001 ACCAAGATCG CCCATACGCC CACATCGGAG CTGGACCTCA AAAGGATCAT AATCTCGCGC 
0061 CCCACCAACG AGGACACATA CGA-GAATTG CGCGCGAGCG GGCAT-TGCG CTAATCCTGA 
0121 ACCACAAGGA TGTCAAGGGA CAGAAGCAGC GCGTGGGCAC CGAACGGGAT CGCGATGACA 
0181 TGGAGGCGAC GCTGCAGGGA TTCGGATTCG ATGTACGCAC CTTCGACGAT CTGACCTTCT 
0241 CCGAGATCAA CGACACGCTC AAAGAGGTTG CTCGGGAGGA TCACAGTCAA AACGACTGCT 
0301 TTGTGTTGGC GGTGATGTCA CACGGCACCG AAGGCAAGGT CTACGCTAAG GACATGTCAT 
0361 ATCCTGTGGA GCGCCTTTGG AATCCCTTCC TCGGCGACAA CTGCAAGACG CTCAAGAACA 
0421 AACCCAAACT CTTCTTCATC CAGGCCTGTC GCGGAGCCAA CCTGGAAAAG GCAGTCGAGT 
0481 TCTCCAGCTT CGCTGTGATG AC 
 Assemble Data

14902R-2.IR_full       1   ACCAAGATCGCCCATACGCCCACATCGGAGCTGGACCTCAAAAGGATCATAATCTCGCGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14902R-2.in silico     1   ACCAAGATCGCCCATACGCCCACATCGGAGCTGGACCTCAAAAGGATCATAATCTCGCGC 60


14902R-2.IR_full       61  CCCACCAACGAGGACACATACGANGAATTGCGCGCGAGCGGGNATNTGCGCTAATCCTGA 120
                           ||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||||
14902R-2.in silico     61  CCCACCAACGAGGACACATACGA-GAATTGCGCGCGAGCGGGCAT-TGCGCTAATCCTGA 120


14902R-2.IR_full       121 ACCACAAGGATGTCAAGGGACAGAAGCAGCGCGTGGGCACCGAACGGGATCGCGATGACA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14902R-2.in silico     121 ACCACAAGGATGTCAAGGGACAGAAGCAGCGCGTGGGCACCGAACGGGATCGCGATGACA 180


14902R-2.IR_full       181 TGGAGGCGACGCTGCAGGGATTCGGATTCGATGTACGCACCTTCGACGATCTGACCTTCT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14902R-2.in silico     181 TGGAGGCGACGCTGCAGGGATTCGGATTCGATGTACGCACCTTCGACGATCTGACCTTCT 240


14902R-2.IR_full       241 CCGAGATCAACGACACGCTCAAAGAGGTTGCTCGCGAGGATCACAGTCAAAACGACTGCT 300
                           |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
14902R-2.in silico     241 CCGAGATCAACGACACGCTCAAAGAGGTTGCTCGGGAGGATCACAGTCAAAACGACTGCT 300


14902R-2.IR_full       301 TTGTGTTGGCGGTGATGTCACACGGCACCGAAGGCAAGGTCTACGCTAAGGACATGTCAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14902R-2.in silico     301 TTGTGTTGGCGGTGATGTCACACGGCACCGAAGGCAAGGTCTACGCTAAGGACATGTCAT 360


14902R-2.IR_full       361 ATCCTGTGGAGCGCCTTTGGAATCCCTTCCTCGGCGACAACTGCAAGACGCTCAAGAACA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14902R-2.in silico     361 ATCCTGTGGAGCGCCTTTGGAATCCCTTCCTCGGCGACAACTGCAAGACGCTCAAGAACA 420


14902R-2.IR_full       421 AACCCAAACTCTTCTTCATCCAGGCCTGTCGNGGAGCCAACCTGGAAAAGGCAGTCGAGT 480
                           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
14902R-2.in silico     421 AACCCAAACTCTTCTTCATCCAGGCCTGTCGCGGAGCCAACCTGGAAAAGGCAGTCGAGT 480


14902R-2.IR_full       481 TCTCCAGCTTCGCTGTGATGAC 502
                           ||||||||||||||||||||||
14902R-2.in silico     481 TCTCCAGCTTCGCTGTGATGAC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_058114.3  CG14902-RA (decay), mRNA 
0   NM_079259.2  CG4974-RA (dally), mRNA 
0   NM_132858.2  CG9056-RA (CG9056), mRNA 
0   NM_078591.2  CG15749-RA (dmrt11E), mRNA 
0   NM_136174.1  CG10659-RA (CG10659), mRNA 
0   NM_140316.2  CG32104-RB (CG32104), mRNA 
0   NM_136935.1  CG8834-RA (CG8834), mRNA 
0   NM_079607.2  CG6174-RA (Arp87C), mRNA 
0   NM_142269.1  CG8925-RA (CG8925), mRNA 
0   NM_176501.1  CG18525-RB, transcript variant B (Spn5), mRNA 
0   NM_080215.2  CG18525-RA, transcript variant A (Spn5), mRNA 
0   NM_170529.2  CG12070-RB, transcript variant B (Sap-r), mRNA 
0   NM_079858.3  CG12070-RA, transcript variant A (Sap-r), mRNA 
0   NM_001043263.1  CG34157-RF, transcript variant F (Dys), mRNA 
0   NM_001043257.1  CG34157-RH, transcript variant H (Dys), mRNA 
0   NM_001043259.1  CG34157-RC, transcript variant C (Dys), mRNA 
0   NM_001043258.1  CG34157-RA, transcript variant A (Dys), mRNA 
0   NM_001043261.1  CG34157-RG, transcript variant G (Dys), mRNA 
0   NM_001043256.1  CG34157-RB, transcript variant B (Dys), mRNA 
0   NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
0   NM_001042986.1  CG17704-RF, transcript variant F (Nipped-B), mRNA 
0   NM_001042987.1  CG17704-RE, transcript variant E (Nipped-B), mRNA 
0   NM_141608.2  CG18005-RA (CG18005), mRNA 
0   NM_001038878.1  CG2956-RB, transcript variant B (twi), mRNA 
0   NM_079092.2  CG2956-RA, transcript variant A (twi), mRNA 
0   NM_143614.1  CG1499-RA, transcript variant A (CG1499), mRNA 
0   NM_170552.1  CG1499-RB, transcript variant B (CG1499), mRNA 
0   15  NM_165181.1  CG17927-RC, transcript variant C (Mhc), mRNA 
0   15  NM_165186.1  CG17927-RD, transcript variant D (Mhc), mRNA 
0   15  NM_165188.1  CG17927-RI, transcript variant I (Mhc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.