National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14816R-6 
 Symbol CG14816  Full Name CG14816 
 CG No CG14816  Old CG No CG14816 
 Synonyms EG:63B12.4, CG14816 
 Accession No (Link to NCBI) NM_130595.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ishida Y, Sekine Y, Oguchi H, Chihara T, Miura M, Ichijo H, Takeda K.
Prevention of apoptosis by mitochondrial phosphatase PGAM5 in the mushroom body is crucial for heat shock resistance in Drosophila melanogaster.
PLoS One (2012) 7(2) e30265 [ PubMed ID = 22347370 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCGAAAGTTGACTAGCTTCG 
 Primer Seq. 3'
aatctagaggtaccACGCAGGAAGGCACAGTTCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGcGAAAGTT GACTAGCTTC GTGTGCGGCA CAGGAGCCGG ACTGGCgGCT TACTACCTAC 
0061 AGCGGCTGCG NGACCCgCAN ACGGTCGTGC AGAACTCGTG GACGCACAGT GATAAGCCGG 
0121 TGGATCCGTG GGCCCTTTGG GACACCAACT GGGATTGCCG GGAACCACGG GCCCTCGTGC 
0181 GTCCACTGCG AAACAGCCAG CCGGAGGAGG AGAACCGCTA CAACGCGGAG CTTGNAGAAG 
0241 GCGAAGGCCA AGAAGGCGCG CCACATTATC CTAGTGCGGC ATGGCGAGTA TCTGGACGTG 
0301 GGTGACTCGG ATGACACGCA TCATCTCACG GAGCGCGGcC GCAAGCAGGC GGAGTTTACT 
0361 GGGAANACGG CTCTGCGAGC TGGGCATCAA GTGGGACAAG GTAGTAGCCT CCACAATGGT 
0421 GCGGGCCCAG GAGACTTCCG ATATTATTCT CAAGCAGATC GATTTCGAAA AAGAGAAAGT 
0481 GGTGAACTGT GCCTTCCTGC GT 
 in silico PCR Fragment
0001 TGCGAAAGTT GACTAGCTTC GTGTGCGGCA CAGGAGCCGG ACTGGCGGCT TACTACCTAC 
0061 AGCGGCTGCG GGACCCGCAG ACGGTCGTGC AGAACTCGTG GACGCACAGT GATAAGCCGG 
0121 TGGATCCGTG GGCCCTTTGG GACACCAACT GGGATTGCCG GGAGCCACGG GCCCTCGTGC 
0181 GTCCACTGCG AAACAGCCAG CCGGAGGAGG AGAACCGCTA CAACGCGGAG CTTG-AGAAG 
0241 GCGAAGGCCA AGAAGGCGCG CCACATTATC CTAGTGCGGC ATGGCGAGTA TCTGGACGTG 
0301 GGTGACTCGG ATGACACGCA TCATCTCACG GAGCGCGGCC GCAAGCAGGC GGAGTTTACT 
0361 GGGAA-ACGG CTCTGCGAGC TGGGCATCAA GTGGGACAAG GTAGTAGCCT CCACAATGGT 
0421 GCGGGCCCAG GAGACTTCCG ATATTATTCT CAAGCAGATC GATTTCGAAA AAGAGAAAGT 
0481 GGTGAACTGT GCCTTCCTGC GT 
 Assemble Data

14816R-6.IR_full       1   TGCGAAAGTTGACTAGCTTCGTGTGCGGCACAGGAGCCGGACTGGCGGCTTACTACCTAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14816R-6.in silico     1   TGCGAAAGTTGACTAGCTTCGTGTGCGGCACAGGAGCCGGACTGGCGGCTTACTACCTAC 60


14816R-6.IR_full       61  AGCGGCTGCGNGACCCGCANACGGTCGTGCAGAACTCGTGGACGCACAGTGATAAGCCGG 120
                           |||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||
14816R-6.in silico     61  AGCGGCTGCGGGACCCGCAGACGGTCGTGCAGAACTCGTGGACGCACAGTGATAAGCCGG 120


14816R-6.IR_full       121 TGGATCCGTGGGCCCTTTGGGACACCAACTGGGATTGCCGGGAACCACGGGCCCTCGTGC 180
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
14816R-6.in silico     121 TGGATCCGTGGGCCCTTTGGGACACCAACTGGGATTGCCGGGAGCCACGGGCCCTCGTGC 180


14816R-6.IR_full       181 GTCCACTGCGAAACAGCCAGCCGGAGGAGGAGAACCGCTACAACGCGGAGCTTGNAGAAG 240
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
14816R-6.in silico     181 GTCCACTGCGAAACAGCCAGCCGGAGGAGGAGAACCGCTACAACGCGGAGCTTG-AGAAG 240


14816R-6.IR_full       241 GCGAAGGCCAAGAAGGCGCGCCACATTATCCTAGTGCGGCATGGCGAGTATCTGGACGTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14816R-6.in silico     241 GCGAAGGCCAAGAAGGCGCGCCACATTATCCTAGTGCGGCATGGCGAGTATCTGGACGTG 300


14816R-6.IR_full       301 GGTGACTCGGATGACACGCATCATCTCACGGAGCGCGGCCGCAAGCAGGCGGAGTTTACT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14816R-6.in silico     301 GGTGACTCGGATGACACGCATCATCTCACGGAGCGCGGCCGCAAGCAGGCGGAGTTTACT 360


14816R-6.IR_full       361 GGGAANACGGCTCTGCGAGCTGGGCATCAAGTGGGACAAGGTAGTAGCCTCCACAATGGT 420
                           ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
14816R-6.in silico     361 GGGAA-ACGGCTCTGCGAGCTGGGCATCAAGTGGGACAAGGTAGTAGCCTCCACAATGGT 420


14816R-6.IR_full       421 GCGGGCCCAGGAGACTTCCGATATTATTCTCAAGCAGATCGATTTCGAAAAAGAGAAAGT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14816R-6.in silico     421 GCGGGCCCAGGAGACTTCCGATATTATTCTCAAGCAGATCGATTTCGAAAAAGAGAAAGT 480


14816R-6.IR_full       481 GGTGAACTGTGCCTTCCTGCGT 502
                           ||||||||||||||||||||||
14816R-6.in silico     481 GGTGAACTGTGCCTTCCTGCGT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_130595.2  CG14816-RA (CG14816), mRNA 
0   NM_140794.2  CG4108-RA (Chmp1), mRNA 
0   NM_078863.4  CG17927-RH, transcript variant H (Mhc), mRNA 
0   NM_165188.1  CG17927-RI, transcript variant I (Mhc), mRNA 
0   NM_165187.1  CG17927-RA, transcript variant A (Mhc), mRNA 
0   NM_165186.1  CG17927-RD, transcript variant D (Mhc), mRNA 
0   NM_165185.1  CG17927-RF, transcript variant F (Mhc), mRNA 
0   NM_165184.1  CG17927-RJ, transcript variant J (Mhc), mRNA 
0   NM_165183.1  CG17927-RE, transcript variant E (Mhc), mRNA 
0   NM_165182.1  CG17927-RG, transcript variant G (Mhc), mRNA 
0   NM_165181.1  CG17927-RC, transcript variant C (Mhc), mRNA 
0   NM_165192.1  CG17927-RM, transcript variant M (Mhc), mRNA 
0   NM_165191.1  CG17927-RL, transcript variant L (Mhc), mRNA 
0   NM_165189.1  CG17927-RB, transcript variant B (Mhc), mRNA 
0   NM_165190.1  CG17927-RK, transcript variant K (Mhc), mRNA 
0   NM_001043247.1  CG6535-RB (tefu), mRNA 
0   NM_166220.1  CG30458-RA (CG30458), mRNA 
0   NM_137226.2  CG8314-RA (CG8314), mRNA 
0   NM_139892.1  CG12262-RA (CG12262), mRNA 
0   NM_170278.1  CG31082-RA (CG31082), mRNA 
0   NM_079018.2  CG10119-RA (LamC), mRNA 
0   12  NM_079817.2  CG1842-RA (Dhc98D), mRNA 
0   NM_137633.1  CG16739-RA (CG16739), mRNA 
0   NM_001043289.1  CG34100-RA, transcript variant A (mld), mRNA 
0   NM_001043290.1  CG34100-RB, transcript variant B (mld), mRNA 
0   NM_140745.1  CG6052-RA (CG6052), mRNA 
0   NM_169503.1  CG32473-RA, transcript variant A (CG32473), mRNA 
0   NM_134484.2  CG14210-RA (CG14210), mRNA 
0   NM_165331.2  CG31687-RA (CG31687), mRNA 
0   NM_136191.2  CG31688-RA (CG31688), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.