National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14789R-3 
 Symbol O-fut2  Full Name O-fucosyltransferase 2 
 CG No CG14789  Old CG No CG14789 
 Synonyms O-FUT2, CG14789, EG:BACN32G11.6, O-fut2, O-fut, Ofut2 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGCTCCTGCTCCTCCATCTG 
 Primer Seq. 3'
aatctagaggtaccAACCGGAAAGCGTGCCCTACA 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

14789R-3.IR full       1   CTGCTCCTGCTCCTCCATCTGCTGACCGGCTCGGATGCCGCCGTCCGGAATGGGACTGCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14789R-3.in silico     1   CTGCTCCTGCTCCTCCATCTGCTGACCGGCTCGGATGCCGCCGTCCGGAATGGGACTGCA 60


14789R-3.IR full       61  AAGCGGGAAATTGGCGATTCCCGGGGAAGCAGCGGCACCTGCGTCAAAGGGTTCCTGCAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14789R-3.in silico     61  AAGCGGGAAATTGGCGATTCCCGGGGAAGCAGCGGCACCTGCGTCAAAGGGTTCCTGCAG 120


14789R-3.IR full       121 GAGATCCTGCCACTGCCAGCGACTTGTCCGCCTGAGGTGCTCGGGATGAGGGGCGCCGTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14789R-3.in silico     121 GAGATCCTGCCACTGCCAGCGACTTGTCCGCCTGAGGTGCTCGGGATGAGGGGCGCCGTG 180


14789R-3.IR full       181 TATATCCTTTACGACGTAAACATCTCCGAGGGCTTCAACCTGCGCCGAGACGTCTATATT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14789R-3.in silico     181 TATATCCTTTACGACGTAAACATCTCCGAGGGCTTCAACCTGCGCCGAGACGTCTATATT 240


14789R-3.IR full       241 CGCATGGCGGTGTTCGTGCGCCGGCTGCAGAGGAGAAAGGCNTTTCGCCATGTGCGCCTT 300
                           ||||||||||||||||||||||||||||||||||||| |   ||||||||||||||||||
14789R-3.in silico     241 CGCATGGCGGTGTTCGTGCGCCGGCTGCAGAGGAGAAGGCGCTTTCGCCATGTGCGCCTT 300


14789R-3.IR full       301 GTGNTGCCGCCGTGGCCCCGCCTCTACCACTGGCACTCGCAGGGCCTGCAGCAATCTGGA 360
                           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14789R-3.in silico     301 GTGCTGCCGCCGTGGCCCCGCCTCTACCACTGGCACTCGCAGGGCCTGCAGCAATCTGGA 360


14789R-3.IR full       361 CTGCCCTGGAGCCACTTCTTCGACTTGGCCAGTNNNNGTNNCTACGCGCCCGTTCTGGAC 420
                           |||||||||||||||||||||||||||||||||    ||  |||||||||||||||||||
14789R-3.in silico     361 CTGCCCTGGAGCCACTTCTTCGACTTGGCCAGTCTGCGTCGCTACGCGCCCGTTCTGGAC 420


14789R-3.IR full       421 TACGAGGAATTCCTGGCCGAACAGCGCTTATTCGGCAATCCTGNNGCACNGCTGGTCCAT 480
                           |||||||||||||||||||||||||||||||||||||||||||  |||| ||||||||||
14789R-3.in silico     421 TACGAGGAATTCCTGGCCGAACAGCGCTTATTCGGCAATCCTGGCGCACCGCTGGTCCAT 480


14789R-3.IR full       481 GTAGGGCACGCTTTCCGGTT 500
                           ||||||||||||||||||||
14789R-3.in silico     481 GTAGGGCACGCTTTCCGGTT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_130560.2  O-fucosyltransferase 2 CG14789-RA (O-fut2), mRNA 
NM_137444.2  CG14496-RA (CG14496), mRNA 
NM_176144.1  CG33144-RA (CG33144), mRNA 
13  NM_166125.2  Stretchin-Mlck CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
NM_166129.2  Stretchin-Mlck CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
NM_142394.1  CG16766-RA (CG16766), mRNA 
NM_167364.1  CG15747-RA (CG15747), mRNA 
NM_079159.2  rhomboid CG1004-RA (rho), mRNA 
NM_143565.2  CG15543-RA (CG15543), mRNA 
NM_135841.4  Smg5 CG8954-RA, transcript variant A (Smg5), mRNA 
NM_165069.1  Smg5 CG8954-RB, transcript variant B (Smg5), mRNA 
NM_080505.2  E(spl) region transcript m7 CG8361-RA (HLHm7), mRNA 
NM_143356.1  CG16918-RA (CG16918), mRNA 
NM_080325.3  lava lamp CG6450-RC (lva), mRNA 
NM_137507.3  sec6 CG5341-RA (sec6), mRNA 
NM_140045.2  CG4447-RA (CG4447), mRNA 
NM_176581.2  CG33204-RA (CG33204), mRNA 
NM_132511.1  CG2444-RA (CG2444), mRNA 
NM_167647.2  kekkon5 CG12199-RB, transcript variant B (kek5), mRNA 
NM_133154.2  kekkon5 CG12199-RA, transcript variant A (kek5), mRNA 
12  20  NM_166936.1  CG32798-RA (CG32798), mRNA 
10  NM_078604.3  highwire CG32592-RA (hiw), mRNA 
10  NM_142487.1  CG7709-RA (CG7709), mRNA 
NM_135357.3  Kinesin-73 CG8183-RA, transcript variant A (Khc-73), mRNA 
NM_176176.1  Kinesin-73 CG8183-RB, transcript variant B (Khc-73), mRNA 
13  NM_166126.1  Stretchin-Mlck CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
NM_080186.2  Heat shock protein 60 related CG2830-RA (Hsp60B), mRNA 
NM_132380.1  CG15311-RA (CG15311), mRNA 
NM_168422.1  tonalli CG7958-RB, transcript variant B (tna), mRNA 
NM_140155.2  tonalli CG7958-RA, transcript variant A (tna), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.