National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14656R-3 
 Symbol CG14656  Full Name CG14656 
 CG No CG14656  Old CG No CG14656 
 Synonyms CG14656 
 Accession No (Link to NCBI) NM_141240.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Lamaze A, Lamouroux A, Vias C, Hung HC, Weber F, Rouyer F.
The E3 ubiquitin ligase CTRIP controls CLOCK levels and PERIOD oscillations in Drosophila.
EMBO Rep. (2011) 12(6) 549-57 [ PubMed ID = 21525955 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Yano H, Yamamoto-Hino M, Awano W, Aoki-Kinoshita KF, Tsuda-Sakurai K, Okano H, Goto S.
Identification of proteasome components required for apical localization of Chaoptin using functional genomics.
J. Neurogenet. (2012) 26(1) 53-63 [ PubMed ID = 22417167 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACGACGACGGTGGTTCAACA 
 Primer Seq. 3'
aatctagaggtaccTTAAGGGGCGCGCAAACCAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CACGACGACG GTGGTTCANA CAGCAACATC AGCGACATTG GCTAATAANA ACCAGTGGGA 
0061 CCAACACNGA CAAAGTGCAT CCAATCACTC GTCCCAGAGG CGACGCAACA ACAACACAAA 
0121 CAGCAACAGA AACAAGAGTC ACCACAAAAA CGAGAAACGC AACGCACCGG CNTACATCAG 
0181 GCCCCGCTGT AAGCTCCTCC GTCGACGTTG TACCCGCCAC CTCGACTGCA TCTGCAACCT 
0241 CTACCCGTCG GTCTCGCAGT CAAGGTCGCC ACTCCTCCGC CGCAGCCCTC AGCAGCAAGG 
0301 AGTCACAAAT CCCCAANGCG cTCCGTggGA GCCATCCGCT CCCCATCTTC ACCAGCATTC 
0361 AACTCCATAC CGGTCGTCAG TGATCANATc gCTNTCGCCC GGCAGTCGTA AGCGCCAGCT 
0421 TAACCAGCAC AACAACAGTA ACAACAAAGC CAGCAGTAGN CACCAATCGG CGCCCGGGGG 
0481 AGATCAGCTG GTTTGCGCGC CCCTNNA 
 in silico PCR Fragment
0001 CACGACGACG GTGGTTCA-A CAGCAACATC AGCGACATTG GCTAATAA-A ACCAGTGGGA 
0061 CCAACAC-GA C-AAGTGCAT CCAATCACTC GTCCCAGAGG CGACGCAACA ACAACACAAA 
0121 CAGCAACAGA AACAAGAGTC ACCACAAAAA CGAGAAACGC AACGCACCGG C-TACATCAG 
0181 GCCCCGCTGT AAGCTCCTCC GTCGACGTTG TACCCGCCAC CTCGACTGCA TCTGCAACCT 
0241 CTACCCGTCG GTCTCGCAGT CAAGGTCGCC ACTCCTCCGC CGCAGCCCTC AGCAGCAAGG 
0301 AGTCACAAAT CCCCAA-GCG CTCCGTGGGA GCCATCCGCT CCCCATCTTC ACCAGCATTC 
0361 AACTCCATAC CGGTCGTCAG TGATCA-ATC GCTATCGCCC GGCAGTCGTA AGCGCCAGCT 
0421 TAACCAGCAC AACAACAGTA ACAACAAAGC CAGCAGTAGC CACCAATCGG CGCCCGGGGG 
0481 AGATCAGCTG GTTTGCGCGC CCCTTAA 
 Assemble Data

14656R-3.IR_full       1   CACGACGACGGTGGTTCANACAGCAACATCAGCGACATTGGCTAATAANAACCAGTGGGA 60
                           |||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||
14656R-3.in silico     1   CACGACGACGGTGGTTCA-ACAGCAACATCAGCGACATTGGCTAATAA-AACCAGTGGGA 60


14656R-3.IR_full       61  CCAACACNGACAAAGTGCATCCAATCACTCGTCCCAGAGGCGACGCAACAACAACACAAA 120
                           ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||
14656R-3.in silico     61  CCAACAC-GAC-AAGTGCATCCAATCACTCGTCCCAGAGGCGACGCAACAACAACACAAA 120


14656R-3.IR_full       121 CAGCAACAGAAACAAGAGTCACCACAAAAACGAGAAACGCAACGCACCGGCNTACATCAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
14656R-3.in silico     121 CAGCAACAGAAACAAGAGTCACCACAAAAACGAGAAACGCAACGCACCGGC-TACATCAG 180


14656R-3.IR_full       181 GCCCCGCTGTAAGCTCCTCCGTCGACGTTGTACCCGCCACCTCGACTGCATCTGCAACCT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14656R-3.in silico     181 GCCCCGCTGTAAGCTCCTCCGTCGACGTTGTACCCGCCACCTCGACTGCATCTGCAACCT 240


14656R-3.IR_full       241 CTACCCGTCGGTCTCGCAGTCAAGGTCGCCACTCCTCCGCCGCAGCCCTCAGCAGCAAGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14656R-3.in silico     241 CTACCCGTCGGTCTCGCAGTCAAGGTCGCCACTCCTCCGCCGCAGCCCTCAGCAGCAAGG 300


14656R-3.IR_full       301 AGTCACAAATCCCCAANGCGCTCCGTGGGAGCCATCCGCTCCCCATCTTCACCAGCATTC 360
                           |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
14656R-3.in silico     301 AGTCACAAATCCCCAA-GCGCTCCGTGGGAGCCATCCGCTCCCCATCTTCACCAGCATTC 360


14656R-3.IR_full       361 AACTCCATACCGGTCGTCAGTGATCANATCGCTNTCGCCCGGCAGTCGTAAGCGCCAGCT 420
                           |||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||
14656R-3.in silico     361 AACTCCATACCGGTCGTCAGTGATCA-ATCGCTATCGCCCGGCAGTCGTAAGCGCCAGCT 420


14656R-3.IR_full       421 TAACCAGCACAACAACAGTAACAACAAAGCCAGCAGTAGNCACCAATCGGCGCCCGGGGG 480
                           ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
14656R-3.in silico     421 TAACCAGCACAACAACAGTAACAACAAAGCCAGCAGTAGCCACCAATCGGCGCCCGGGGG 480


14656R-3.IR_full       481 AGATCAGCTGGTTTGCGCGCCCCTNNA 507
                           ||||||||||||||||||||||||  |
14656R-3.in silico     481 AGATCAGCTGGTTTGCGCGCCCCTTAA 507

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  19  NM_141240.1  CG14656-RA (CG14656), mRNA 
0.41   NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0.2   22  NM_078589.2  CG1903-RB, transcript variant B (sno), mRNA 
0.2   22  NM_167353.1  CG1903-RA, transcript variant A (sno), mRNA 
0.2   17  NM_139661.2  CG7471-RA (Rpd3), mRNA 
0   12  46  NM_142521.1  CG6026-RA (CG6026), mRNA 
0   15  NM_001042820.1  CG34145-RA (CG34145), mRNA 
0   NM_136810.1  CG9079-RA (CG9079), mRNA 
0   15  NM_137342.2  CG30460-RC, transcript variant C (CG30460), mRNA 
0   24  104  NM_135077.2  CG14023-RA (CG14023), mRNA 
0   29  NM_078731.2  CG3166-RB, transcript variant B (aop), mRNA 
0   15  NM_176121.1  CG33183-RC, transcript variant C (Hr46), mRNA 
0   NM_135800.2  CG6565-RA (CG6565), mRNA 
0   NM_141697.1  CG9461-RA (CG9461), mRNA 
0   NM_206712.1  CG33248-RA (CG33248), mRNA 
0   14  24  NM_135454.4  CG3838-RB, transcript variant B (CG3838), mRNA 
0   11  47  NM_206684.2  CG1725-RE, transcript variant E (dlg1), mRNA 
0   11  47  NM_206682.2  CG1725-RG, transcript variant G (dlg1), mRNA 
0   11  47  NM_167282.2  CG1725-RA, transcript variant A (dlg1), mRNA 
0   11  47  NM_078565.3  CG1725-RD, transcript variant D (dlg1), mRNA 
0   64  NM_137212.2  CG30089-RA (CG30089), mRNA 
0   34  NM_057520.3  CG3497-RA (Su(H)), mRNA 
0   20  NM_206636.1  CG3960-RF, transcript variant F (CG3960), mRNA 
0   17  NM_139802.2  CG32392-RB, transcript variant B (CG32392), mRNA 
0   46  NM_169292.2  CG9381-RC, transcript variant C (mura), mRNA 
0   27  NM_080323.2  CG10798-RA (dm), mRNA 
0   24  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   24  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   14  NM_206007.1  CG33316-RA, transcript variant A (CG33316), mRNA 
0   14  NM_206008.1  CG33316-RB, transcript variant B (CG33316), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.