National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14642R-2 
 Symbol CG14642  Full Name CG14642 
 CG No CG14642  Old CG No CG14642 
 Synonyms SP29, CG14642 
 Accession No (Link to NCBI) NM_141184.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGCAATCTGTCCGTGTGTCTG 
 Primer Seq. 3'
aatctagaggtaccTGCCCTCTGTCCGACTCGAAG 
 Predicted Fragment Size
483 
 IR fragment full Seq
0001 CGCAATCTGT CCGTGTGTCT GATATCATTT ATCGGGCTCT GGTGCCTGAG CAATACTCAC 
0061 ACCCAGCGCC TGCCCCCAGA AgGGCGAATG CGCCCCTTGC AAGACGACTC GATCCGCTCT 
0121 CCCGTGGACC GCGACATAGT CTTTCCGGAG TTAGACGCGG GACCAGGCAA GCCCGAGGAG 
0181 AAGATGTGGT TTCACATAAC AGACTTTCAA TTTGATCGGG TGGAGGGCCC GACCCAGCCC 
0241 AAGCCCAAGC CCAGACAATA CCCCCCGCCG CCGATGCCCG GCCAGCCCTT TCCGCCGCCC 
0301 CCCGGGGGCT TTAAAAAGAA GGAAAACAAG CAACGCCGCC TCTGCGAGCA AAAATATTCC 
0361 GAATATGTGG AGCGCATCTT TCCCAATGAT ACCGCAGTGG CTGCCGATGC CAACGACGCA 
0421 GACTTCGATG GTCGGGTACC TGGCCCGGCC CGGCTGNCGT GGGCTATCGA GTCGGACAGA 
0481 GGGCA 
 in silico PCR Fragment
0001 CGCAATCTGT CCGTGTGTCT GATATCATTT ATCGGGCTCT GGTGCCTGAG CAATACTCAC 
0061 ACCCAGCGCC TGCCCCCAGA AGGGCGAATG CGCCCCTTGC AAGACGACTC GATCCGCTCT 
0121 CCCGTGGACC GCGACATAGT CTTTCCGGAG TTAGACGCGG GACCAGGCAA GCCCGAGGAG 
0181 AAGATGTGGT TTCACATAAC AGACTTTCAA TTTGATCGGG TGGAGGGCCC GACCCAGCCC 
0241 AAGCCCAAGC CCAGACAATA CCCCCCGCCG CCGATGCCCG GCCAGCCCTT TCCGCCGCCC 
0301 CCCGGGGGCT TTAAAAAGAA GGAAAACAAG CAACGCCGCC TCTGCGAGCA AAAATATTCC 
0361 GAATATGTGG AGCGCATCTT TCCCAATGAT ACCGCAGTGG CTGCCGATGC CAACGACGCA 
0421 GACTTCGATG GTCGGGT-CC TGGCCCGGCC CGGCTGCCGT GGGCT-TCGA GTCGGACAGA 
0481 GGGCA 
 Assemble Data

14642R-2.IR_full       1   CGCAATCTGTCCGTGTGTCTGATATCATTTATCGGGCTCTGGTGCCTGAGCAATACTCAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14642R-2.in silico     1   CGCAATCTGTCCGTGTGTCTGATATCATTTATCGGGCTCTGGTGCCTGAGCAATACTCAC 60


14642R-2.IR_full       61  ACCCAGCGCCTGCCCCCAGAAGGGCGAATGCGCCCCTTGCAAGACGACTCGATCCGCTCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14642R-2.in silico     61  ACCCAGCGCCTGCCCCCAGAAGGGCGAATGCGCCCCTTGCAAGACGACTCGATCCGCTCT 120


14642R-2.IR_full       121 CCCGTGGACCGCGACATAGTCTTTCCGGAGTTAGACGCGGGACCAGGCAAGCCCGAGGAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14642R-2.in silico     121 CCCGTGGACCGCGACATAGTCTTTCCGGAGTTAGACGCGGGACCAGGCAAGCCCGAGGAG 180


14642R-2.IR_full       181 AAGATGTGGTTTCACATAACAGACTTTCAATTTGATCGGGTGGAGGGCCCGACCCAGCCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14642R-2.in silico     181 AAGATGTGGTTTCACATAACAGACTTTCAATTTGATCGGGTGGAGGGCCCGACCCAGCCC 240


14642R-2.IR_full       241 AAGCCCAAGCCCAGACAATACCCCCCGCCGCCGATGCCCGGCCAGCCCTTTCCGCCGCCC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14642R-2.in silico     241 AAGCCCAAGCCCAGACAATACCCCCCGCCGCCGATGCCCGGCCAGCCCTTTCCGCCGCCC 300


14642R-2.IR_full       301 CCCGGGGGCTTTAAAAAGAAGGAAAACAAGCAACGCCGCCTCTGCGAGCAAAAATATTCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14642R-2.in silico     301 CCCGGGGGCTTTAAAAAGAAGGAAAACAAGCAACGCCGCCTCTGCGAGCAAAAATATTCC 360


14642R-2.IR_full       361 GAATATGTGGAGCGCATCTTTCCCAATGATACCGCAGTGGCTGCCGATGCCAACGACGCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14642R-2.in silico     361 GAATATGTGGAGCGCATCTTTCCCAATGATACCGCAGTGGCTGCCGATGCCAACGACGCA 420


14642R-2.IR_full       421 GACTTCGATGGTCGGGTACCTGGCCCGGCCCGGCTGNCGTGGGCTATCGAGTCGGACAGA 480
                           ||||||||||||||||| |||||||||||||||||| |||||||| ||||||||||||||
14642R-2.in silico     421 GACTTCGATGGTCGGGT-CCTGGCCCGGCCCGGCTGCCGTGGGCT-TCGAGTCGGACAGA 480


14642R-2.IR_full       481 GGGCA 485
                           |||||
14642R-2.in silico     481 GGGCA 485

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164322.1  CG14642-RB, transcript variant B (CG14642), mRNA 
93.15   449  NM_141184.2  CG14642-RA, transcript variant A (CG14642), mRNA 
0.2   12  NM_140149.2  CG8003-RA (CG8003), mRNA 
0   17  19  NM_080312.2  CG7803-RA, transcript variant A (z), mRNA 
0   17  19  NM_001038738.1  CG7803-RB, transcript variant B (z), mRNA 
0   NM_133081.1  CG15047-RA (CG15047), mRNA 
0   NM_132650.1  CG10617-RA (CG10617), mRNA 
0   NM_168124.1  CG10596-RC, transcript variant C (Msr-110), mRNA 
0   NM_168123.1  CG10596-RA, transcript variant A (Msr-110), mRNA 
0   NM_139716.2  CG10596-RB, transcript variant B (Msr-110), mRNA 
0   NM_001042830.1  CG41474-RA (CG41474), mRNA 
0   NM_134962.2  CG31772-RA (CG31772), mRNA 
0   NM_057419.2  CG5619-RA (trk), mRNA 
0   NM_132858.2  CG9056-RA (CG9056), mRNA 
0   NM_136508.2  CG8711-RA (cul-4), mRNA 
0   NM_137043.2  CG13333-RA (CG13333), mRNA 
0   NM_057469.3  CG10718-RA (neb), mRNA 
0   NM_169733.2  CG10325-RB, transcript variant B (abd-A), mRNA 
0   NM_057345.2  CG10325-RA, transcript variant A (abd-A), mRNA 
0   NM_135691.1  CG6734-RA (CG6734), mRNA 
0   NM_168087.1  CG32241-RA (CG32241), mRNA 
0   NM_137034.2  CG17064-RA (mars), mRNA 
0   NM_136687.2  CG1472-RA (sec24), mRNA 
0   NM_132621.1  CG12715-RA (CG12715), mRNA 
0   NM_169036.1  CG31543-RC, transcript variant C (Hph), mRNA 
0   NM_141268.2  CG31543-RA, transcript variant A (Hph), mRNA 
0   NM_169037.1  CG31543-RB, transcript variant B (Hph), mRNA 
0   NM_164524.1  CG9660-RD, transcript variant D (toc), mRNA 
0   NM_057805.2  CG9660-RA, transcript variant A (toc), mRNA 
0   NM_164953.1  CG16833-RB, transcript variant B (CG16833), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.