National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1462R-2 
 Symbol Aph-4  Full Name Alkaline phosphatase 4 
 CG No CG1462  Old CG No CG1462 
 Synonyms CG1462, pMY51, l(3)07028, AP, unnamed, Aph, Aph-4 
 Accession No (Link to NCBI) NM_079862.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem. Biophys. Res. Commun. (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTTCTGCTGGGTAGCCTGGTG 
 Primer Seq. 3'
aatctagaggtaccTGCTGCCCATTCTTCTTGGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTTCTGCTGG GTAGCCTGGT GGCATTCAGC TGGGCAGGAG TCACAACCCA GCCACCGCCA 
0061 CTCATACGCA CCCTGAGTGC CGGCGGAGAC ATAGGACCCC AGTTCGACGT GGGGAAGACC 
0121 AAGGAACCCG AAGACGCGGA ATTCTGGCAC AACGTGGGCC TGAGGCAGCT GGAGAAGACC 
0181 ATTAAGCAGG CGCAGCGCGT GAAGGAGGAC TCCTACCAGA AAAAGGCGCG GAATATCATC 
0241 ATCTTCATCG GAGACGGCAT GGGAATATCC ACGATCAGTG CTGGTCGCAT CTACAAGGGG 
0301 CAGTACCTGA AGCATGGTTA CGGCGAGGAG GAAACCCTCG TCTTCGACGA TTTCCCAAAC 
0361 ACTGGAATGG CCAAAACCTA CAACGTGGAC AAACAAGTGC CGGATTCGGC GGGCACTGCC 
0421 ACTGCGATCT TCTCGGGTTC GAAAACCCAT TACGGAGCCA TTGGAATGGN ACGCCACCCG 
0481 CTCCAAGAAG AATGGGCCAG CA 
 in silico PCR Fragment
0001 TTTCTGCTGG GTAGCCTGGT GGCATTCAGC TGGGCAGGAG TCACAACCCA GCCACCGCCA 
0061 CTCATACGCA CCCTAAGTGC CGGCGGAGAC ATAGGACCCC AGTTCGACGT GGGGAAGACC 
0121 AAGGAACCCG AAGACGCGGA ATTCTGGCAC AACGTGGGCC TGAGGCAGCT GGAGAAGACC 
0181 ATTAAGCAGG CGCAGCGCGT GAAGGAGGAC TCCTACCAGA AAAAGGCGCG GAATATCATC 
0241 ATCTTCATCG GAGACGGCAT GGGAATATCC ACGATCAGTG CTGGTCGCAT CTACAAGGGG 
0301 CAGTACCTGA AGCATGGTTA CGGCGAGGAG GAAACCCTCG TCTTCGACGA TTTCCCAAAC 
0361 ACTGGAATGG CCAAAACCTA CAACGTGGAC AAACAAGTGC CGGATTCGGC GGGCACTGCC 
0421 ACTGCGATCT TCTCGGGTTC GAAAACCCAT TACGGAGCCA TTGGAATGG- ACGCCACCCG 
0481 CTCCAAGAAG AATGGG-CAG CA 
 Assemble Data

1462R-2.IR_full       1   TTTCTGCTGGGTAGCCTGGTGGCATTCAGCTGGGCAGGAGTCACAACCCAGCCACCGCCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1462R-2.in silico     1   TTTCTGCTGGGTAGCCTGGTGGCATTCAGCTGGGCAGGAGTCACAACCCAGCCACCGCCA 60


1462R-2.IR_full       61  CTCATACGCACCCTGAGTGCCGGCGGAGACATAGGACCCCAGTTCGACGTGGGGAAGACC 120
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
1462R-2.in silico     61  CTCATACGCACCCTAAGTGCCGGCGGAGACATAGGACCCCAGTTCGACGTGGGGAAGACC 120


1462R-2.IR_full       121 AAGGAACCCGAAGACGCGGAATTCTGGCACAACGTGGGCCTGAGGCAGCTGGAGAAGACC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1462R-2.in silico     121 AAGGAACCCGAAGACGCGGAATTCTGGCACAACGTGGGCCTGAGGCAGCTGGAGAAGACC 180


1462R-2.IR_full       181 ATTAAGCAGGCGCAGCGCGTGAAGGAGGACTCCTACCAGAAAAAGGCGCGGAATATCATC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1462R-2.in silico     181 ATTAAGCAGGCGCAGCGCGTGAAGGAGGACTCCTACCAGAAAAAGGCGCGGAATATCATC 240


1462R-2.IR_full       241 ATCTTCATCGGAGACGGCATGGGAATATCCACGATCAGTGCTGGTCGCATCTACAAGGGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1462R-2.in silico     241 ATCTTCATCGGAGACGGCATGGGAATATCCACGATCAGTGCTGGTCGCATCTACAAGGGG 300


1462R-2.IR_full       301 CAGTACCTGAAGCATGGTTACGGCGAGGAGGAAACCCTCGTCTTCGACGATTTCCCAAAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1462R-2.in silico     301 CAGTACCTGAAGCATGGTTACGGCGAGGAGGAAACCCTCGTCTTCGACGATTTCCCAAAC 360


1462R-2.IR_full       361 ACTGGAATGGCCAAAACCTACAACGTGGACAAACAAGTGCCGGATTCGGCGGGCACTGCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1462R-2.in silico     361 ACTGGAATGGCCAAAACCTACAACGTGGACAAACAAGTGCCGGATTCGGCGGGCACTGCC 420


1462R-2.IR_full       421 ACTGCGATCTTCTCGGGTTCGAAAACCCATTACGGAGCCATTGGAATGGNACGCCACCCG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
1462R-2.in silico     421 ACTGCGATCTTCTCGGGTTCGAAAACCCATTACGGAGCCATTGGAATGG-ACGCCACCCG 480


1462R-2.IR_full       481 CTCCAAGAAGAATGGGCCAGCA 502
                          |||||||||||||||| |||||
1462R-2.in silico     481 CTCCAAGAAGAATGGG-CAGCA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079862.2  CG1462-RA, transcript variant A (Aph-4), mRNA 
72.82   351  NM_170534.1  CG1462-RB, transcript variant B (Aph-4), mRNA 
0   NM_079994.3  CG12630-RA (tio), mRNA 
0   NM_176541.1  CG31158-RB, transcript variant B (CG31158), mRNA 
0   NM_170027.2  CG31158-RA, transcript variant A (CG31158), mRNA 
0   NM_140264.1  CG5897-RA (CG5897), mRNA 
0   NM_078803.1  CG4105-RA (Cyp4e3), mRNA 
0   NM_079927.2  CG5105-RA (Plap), mRNA 
0   NM_142986.2  CG5720-RA (CG5720), mRNA 
0   NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_057893.3  CG5799-RB, transcript variant B (dve), mRNA 
0   NM_057894.3  CG5799-RA, transcript variant A (dve), mRNA 
0   NM_141813.2  CG6728-RA (ninaG), mRNA 
0   NM_140258.2  CG7264-RA (CG7264), mRNA 
0   NM_001031862.1  CG33950-RC, transcript variant C (trol), mRNA 
0   NM_001031864.1  CG33950-RE, transcript variant E (trol), mRNA 
0   NM_001031867.1  CG33950-RF, transcript variant F (trol), mRNA 
0   NM_001031866.1  CG33950-RA, transcript variant A (trol), mRNA 
0   NM_001031863.1  CG33950-RD, transcript variant D (trol), mRNA 
0   NM_001031865.1  CG33950-RB, transcript variant B (trol), mRNA 
0   NM_133036.1  CG15373-RA (CG15373), mRNA 
0   NM_079448.2  CG8287-RA (Rab8), mRNA 
0   16  NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0   NM_057863.3  CG8418-RA (Ric), mRNA 
0   NM_165793.1  CG11883-RA, transcript variant A (CG11883), mRNA 
0   NM_136754.3  CG11883-RB, transcript variant B (CG11883), mRNA 
0   NM_206728.1  CG9012-RD, transcript variant D (Chc), mRNA 
0   NM_206729.1  CG9012-RC, transcript variant C (Chc), mRNA 
0   NM_057694.2  CG9012-RA, transcript variant A (Chc), mRNA 
0   NM_167466.1  CG9012-RB, transcript variant B (Chc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.