National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  

Suspension of shipments during Golden Week Holidays: From 4 May to 11 May, deadline 21 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1462R-2 
 Symbol Aph-4  Full Name Alkaline phosphatase 4 
 CG No CG1462  Old CG No CG1462 
 Synonyms CG1462, pMY51, l(3)07028, AP, unnamed, Aph, Aph-4 
 Accession No (Link to NCBI) NM_079862.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem Biophys Res Commun (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TTTCTGCTGGGTAGCCTGGTGGCATTCAGCTGGGCAGGAGTCACAACCCAGCCACCGCCA 60

                          |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| silico     61  CTCATACGCACCCTAAGTGCCGGCGGAGACATAGGACCCCAGTTCGACGTGGGGAAGACC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAGGAACCCGAAGACGCGGAATTCTGGCACAACGTGGGCCTGAGGCAGCTGGAGAAGACC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATTAAGCAGGCGCAGCGCGTGAAGGAGGACTCCTACCAGAAAAAGGCGCGGAATATCATC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATCTTCATCGGAGACGGCATGGGAATATCCACGATCAGTGCTGGTCGCATCTACAAGGGG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CAGTACCTGAAGCATGGTTACGGCGAGGAGGAAACCCTCGTCTTCGACGATTTCCCAAAC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ACTGGAATGGCCAAAACCTACAACGTGGACAAACAAGTGCCGGATTCGGCGGGCACTGCC 420

                          ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| silico     421 ACTGCGATCTTCTCGGGTTCGAAAACCCATTACGGAGCCATTGGAATGG-ACGCCACCCG 480

1462R-2.IR_full       481 CTCCAAGAAGAATGGGCCAGCA 502
                          |||||||||||||||| ||||| silico     481 CTCCAAGAAGAATGGG-CAGCA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079862.2  CG1462-RA, transcript variant A (Aph-4), mRNA 
72.82   351  NM_170534.1  CG1462-RB, transcript variant B (Aph-4), mRNA 
0   NM_079994.3  CG12630-RA (tio), mRNA 
0   NM_176541.1  CG31158-RB, transcript variant B (CG31158), mRNA 
0   NM_170027.2  CG31158-RA, transcript variant A (CG31158), mRNA 
0   NM_140264.1  CG5897-RA (CG5897), mRNA 
0   NM_078803.1  CG4105-RA (Cyp4e3), mRNA 
0   NM_079927.2  CG5105-RA (Plap), mRNA 
0   NM_142986.2  CG5720-RA (CG5720), mRNA 
0   NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_057893.3  CG5799-RB, transcript variant B (dve), mRNA 
0   NM_057894.3  CG5799-RA, transcript variant A (dve), mRNA 
0   NM_141813.2  CG6728-RA (ninaG), mRNA 
0   NM_140258.2  CG7264-RA (CG7264), mRNA 
0   NM_001031862.1  CG33950-RC, transcript variant C (trol), mRNA 
0   NM_001031864.1  CG33950-RE, transcript variant E (trol), mRNA 
0   NM_001031867.1  CG33950-RF, transcript variant F (trol), mRNA 
0   NM_001031866.1  CG33950-RA, transcript variant A (trol), mRNA 
0   NM_001031863.1  CG33950-RD, transcript variant D (trol), mRNA 
0   NM_001031865.1  CG33950-RB, transcript variant B (trol), mRNA 
0   NM_133036.1  CG15373-RA (CG15373), mRNA 
0   NM_079448.2  CG8287-RA (Rab8), mRNA 
0   16  NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0   NM_057863.3  CG8418-RA (Ric), mRNA 
0   NM_165793.1  CG11883-RA, transcript variant A (CG11883), mRNA 
0   NM_136754.3  CG11883-RB, transcript variant B (CG11883), mRNA 
0   NM_206728.1  CG9012-RD, transcript variant D (Chc), mRNA 
0   NM_206729.1  CG9012-RC, transcript variant C (Chc), mRNA 
0   NM_057694.2  CG9012-RA, transcript variant A (Chc), mRNA 
0   NM_167466.1  CG9012-RB, transcript variant B (Chc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.