National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14619R-1 
 Symbol CG14619  Full Name CG14619 
 CG No CG14619  Old CG No CG14619 
 Synonyms CG14619 
 Accession No (Link to NCBI) NM_134618.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Fernández-Espartero CH, Rizzo A, Fulford AD, Falo-Sanjuan J, Goutte-Gattat D, Ribeiro PS.
Prp8 regulates oncogene-induced hyperplastic growth in Drosophila.
Development (2018) 145(22) [ PubMed ID = 30333215 ] [ RRC reference ]

Zhang J, Liu M, Su Y, Du J, Zhu AJ.
A targeted in vivo RNAi screen reveals deubiquitinases as new regulators of Notch signaling.
G3 (Bethesda) (2012) 2(12) 1563-75 [ PubMed ID = 23275879 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCACGGGAGTAGAGCAGGCA 
 Primer Seq. 3'
aatctagaggtaccCCGCACAGACCTTCGGACTTC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCACGGGAG TAGAGCAGGC AGGCCCAGCA GCTCCACCAC CGACGCCACC ACCACCGCCA 
0061 CCACCTCCAC CACCCACAAA TGGCCACAAG CCGGCTGAAT CGAATGGCGG ACTGGAAGCC 
0121 AAATTAAACG GTCTATCGCT GCTCTCAACT TCACCCAAAA GAAATGCCAT TTACGAACGA 
0181 AATCAGGAGA CCGCCGATGA TGCAGGTGTT AGCCAGGATA CTGCGGACAA TGCCGATGTG 
0241 AGCACCTCGG CCACATTTAA GCTAAACGAC AGCAGCAAGA CGTTGGCGAG AAGTGGCACT 
0301 GGGAGTAGCA GCACTGCCCG GAGCGTCCTG CCGCCCATGA CGCCTACGTC AAGTCGGTAC 
0361 TGGGATCGGG acANCGGCAC CAGCCGCAGC AGCATAGGCA CCTCCTCCGC ACTGAACTCG 
0421 TCATCCCTGA AACATAACTC GGATGATGGC TACAAGACCG CCTNCCTCTT CGCGGGATGA 
0481 GAAGTCCGAA GGTCTGTGCG G 
 in silico PCR Fragment
0001 AGCACGGGAG TAGAGCAGGC AGGCCCAGCA GCTCCACCAC CGACGCCACC ACCACCGCCA 
0061 CCACCTCCAC CACCCACAAA TGGCCACAAG CCGGCTGAAT CGAATGGCGG ACTGGAAGCC 
0121 AAATTAAACG GTCTATCTCT GCTCTCAACT TCACCCAAAA GAAATGCCAT TTACGAACGA 
0181 AATCAGGAGA CCGCCGATGA TGCAGGTGTT AGCCAGGATA CTGCGGACAA TGCCGATGTG 
0241 AGCACCTCGG CCACATTTAA GCTAAACGAC AGCAGCAAGA CGTTGGCGAG AAGTGGCACT 
0301 GGGAGTAGCA GCACTGCCCG GAGCGTCCTG CCGCCCATGA CGCCTACGTC AAGTCGGTAC 
0361 TGGGATCGGG ACAGCGGCAC CAGCCGCAGC AGCATAGGCA CCTCCTCCGC ACTGAACTCG 
0421 TCATCCCTGA AACATAACTC GGATGATGGC TACAAGACCG CCT-CCTCTT CGCGGGATGA 
0481 GAAGTCCGAA GGTCTGTGCG G 
 Assemble Data

14619R-1.IR_full       1   AGCACGGGAGTAGAGCAGGCAGGCCCAGCAGCTCCACCACCGACGCCACCACCACCGCCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14619R-1.in silico     1   AGCACGGGAGTAGAGCAGGCAGGCCCAGCAGCTCCACCACCGACGCCACCACCACCGCCA 60


14619R-1.IR_full       61  CCACCTCCACCACCCACAAATGGCCACAAGCCGGCTGAATCGAATGGCGGACTGGAAGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14619R-1.in silico     61  CCACCTCCACCACCCACAAATGGCCACAAGCCGGCTGAATCGAATGGCGGACTGGAAGCC 120


14619R-1.IR_full       121 AAATTAAACGGTCTATCGCTGCTCTCAACTTCACCCAAAAGAAATGCCATTTACGAACGA 180
                           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
14619R-1.in silico     121 AAATTAAACGGTCTATCTCTGCTCTCAACTTCACCCAAAAGAAATGCCATTTACGAACGA 180


14619R-1.IR_full       181 AATCAGGAGACCGCCGATGATGCAGGTGTTAGCCAGGATACTGCGGACAATGCCGATGTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14619R-1.in silico     181 AATCAGGAGACCGCCGATGATGCAGGTGTTAGCCAGGATACTGCGGACAATGCCGATGTG 240


14619R-1.IR_full       241 AGCACCTCGGCCACATTTAAGCTAAACGACAGCAGCAAGACGTTGGCGAGAAGTGGCACT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14619R-1.in silico     241 AGCACCTCGGCCACATTTAAGCTAAACGACAGCAGCAAGACGTTGGCGAGAAGTGGCACT 300


14619R-1.IR_full       301 GGGAGTAGCAGCACTGCCCGGAGCGTCCTGCCGCCCATGACGCCTACGTCAAGTCGGTAC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14619R-1.in silico     301 GGGAGTAGCAGCACTGCCCGGAGCGTCCTGCCGCCCATGACGCCTACGTCAAGTCGGTAC 360


14619R-1.IR_full       361 TGGGATCGGGACANCGGCACCAGCCGCAGCAGCATAGGCACCTCCTCCGCACTGAACTCG 420
                           ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
14619R-1.in silico     361 TGGGATCGGGACAGCGGCACCAGCCGCAGCAGCATAGGCACCTCCTCCGCACTGAACTCG 420


14619R-1.IR_full       421 TCATCCCTGAAACATAACTCGGATGATGGCTACAAGACCGCCTNCCTCTTCGCGGGATGA 480
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
14619R-1.in silico     421 TCATCCCTGAAACATAACTCGGATGATGGCTACAAGACCGCCT-CCTCTTCGCGGGATGA 480


14619R-1.IR_full       481 GAAGTCCGAAGGTCTGTGCGG 501
                           |||||||||||||||||||||
14619R-1.in silico     481 GAAGTCCGAAGGTCTGTGCGG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  54  NM_167776.1  CG14619-RE, transcript variant E (CG14619), mRNA 
100   482  10  54  NM_167775.1  CG14619-RD, transcript variant D (CG14619), mRNA 
100   482  10  54  NM_134618.2  CG14619-RA, transcript variant A (CG14619), mRNA 
42.11   203  NM_167777.1  CG14619-RC, transcript variant C (CG14619), mRNA 
1.45   42  NM_206153.1  CG33130-RC, transcript variant C (l(2)k07433), mRNA 
1.45   39  NM_206154.1  CG33130-RB, transcript variant B (l(2)k07433), mRNA 
1.45   39  NM_176218.1  CG33130-RA, transcript variant A (l(2)k07433), mRNA 
0.62   75  NM_139645.2  CG15021-RA (CG15021), mRNA 
0.62   23  NM_135130.1  CG9050-RA (CG9050), mRNA 
0.62   13  29  NM_141807.1  CG5214-RA (CG5214), mRNA 
0.62   19  NM_132044.1  CG15764-RA (CG15764), mRNA 
0.41   14  48  88  NM_169141.1  CG1021-RA, transcript variant A (CG1021), mRNA 
0.41   14  48  88  NM_141397.2  CG1021-RB, transcript variant B (CG1021), mRNA 
0.41   12  24  70  NM_165522.1  CG11112-RB, transcript variant B (CG11112), mRNA 
0.41   11  66  166  NM_142330.1  CG5225-RA (CG5225), mRNA 
0.41   10  49  NM_139648.1  CG15022-RA (CG15022), mRNA 
0.41   46  92  NM_136925.1  CG30042-RA (CG30042), mRNA 
0.41   45  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
0.41   32  NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
0.41   32  NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
0.41   35  NM_001014706.1  CG13376-RA (CG13376), mRNA 
0.2   16  30  77  NM_168755.1  CG8127-RB, transcript variant B (Eip75B), mRNA 
0.2   26  83  NM_139585.2  CG10853-RA (CG10853), mRNA 
0.2   10  32  NM_166911.3  CG3848-RD, transcript variant D (trr), mRNA 
0.2   10  32  NM_080301.2  CG3848-RC, transcript variant C (trr), mRNA 
0.2   31  NM_079195.2  CG15002-RB (mas), mRNA 
0.2   12  NM_169585.1  CG8087-RA (CG8087), mRNA 
0.2   15  NM_001014674.1  CG6354-RF, transcript variant F (Rb97D), mRNA 
0.2   15  NM_170293.2  CG6354-RA, transcript variant A (Rb97D), mRNA 
0.2   15  NM_001014677.1  CG6354-RC, transcript variant C (Rb97D), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.