National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14517R-3 
 Symbol beta4GalNAcTB  Full Name beta4GalNAcTB 
 CG No CG14517  Old CG No CG14517 
 Synonyms CG14517, dbeta4GalTB, beta4GalTB, beta4GalNAcTB 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTTCGTGCGGCTCTGGGTC 
 Primer Seq. 3'
aatctagaggtaccACCTGGGCGCCAATGTTGAAGAGCAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

14517R-3.IR full       1   ATGTTCGTGCGGCTCTGGGTCCG-AGCTTCCATAAATATGATCTTCTCATCGCCATCGGA 60
                           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
14517R-3.in silico     1   ATGTTCGTGCGGCTCTGGGTCCGCAGCTTCCATAAATATGATCTTCTCATCGCCATCGGA 60


14517R-3.IR full       61  CTGATCACTCTCATCGTGTACCTGTGTCTGCCCTTCCGGTTCGCATCGCACTACGACTAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14517R-3.in silico     61  CTGATCACTCTCATCGTGTACCTGTGTCTGCCCTTCCGGTTCGCATCGCACTACGACTAC 120


14517R-3.IR full       121 ATCGAGGAATCAAAGATCGAGGGGGCTCTGGTGCCGCAGGTGACCAGAAATGTCTCCCAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14517R-3.in silico     121 ATCGAGGAATCAAAGATCGAGGGGGCTCTGGTGCCGCAGGTGACCAGAAATGTCTCCCAG 180


14517R-3.IR full       181 CAGGAAGTTTTCGAATGCACCTACTCGGAGATCATTGCCGAAAACCGGTTCGTCTACCAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14517R-3.in silico     181 CAGGAAGTTTTCGAATGCACCTACTCGGAGATCATTGCCGAAAACCGGTTCGTCTACCAC 240


14517R-3.IR full       241 CTGGCCCATTACCATGACGCGGTGCAGAGGGGCGCGGAGATCCGTCCTGGCGGCGAGTTC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14517R-3.in silico     241 CTGGCCCATTACCATGACGCGGTGCAGAGGGGCGCGGAGATCCGTCCTGGCGGCGAGTTC 300


14517R-3.IR full       301 CGTCCGGAAGGATGTCAGGCTCGCTACAGCACCGCCATCATTGTGCCGTACAGGCAGCGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14517R-3.in silico     301 CGTCCGGAAGGATGTCAGGCTCGCTACAGCACCGCCATCATTGTGCCGTACAGGCAGCGG 360


14517R-3.IR full       361 GAGGAGCAGCTGCACGCCTTCCTCACGTACATGCACAATTACCTGCCGCAGCAGCTGATC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14517R-3.in silico     361 GAGGAGCAGCTGCACGCCTTCCTCACGTACATGCACAATTACCTGCCGCAGCAGCTGATC 420


14517R-3.IR full       421 CACTATCGGATTTTCCTGGTCGAACAGTTCGATCATAAGCCGTTTAACAGGGCGATGCTC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14517R-3.in silico     421 CACTATCGGATTTTCCTGGTCGAACAGTTCGATCATAAGCCGTTTAACAGGGCGATGCTC 480


14517R-3.IR full       481 TTCAACATTGGCGCCCAGGTGG 502
                           ||||||||||||||||||||  
14517R-3.in silico     481 TTCAACATTGGCGCCCAGGT-- 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_143400.1  beta4GalNAcTB CG14517-RA (beta4GalNAcTB), mRNA 
0.2  NM_135211.2  Organic anion transporting polypeptide 26F CG31634-RA (Oatp26F), mRNA 
NM_143325.2  CG12876-RA (CG12876), mRNA 
NM_137008.1  CG4670-RA (CG4670), mRNA 
NM_057473.3  tamas CG8987-RA (tam), mRNA 
NM_166335.2  CG7097-RA, transcript variant A (CG7097), mRNA 
NM_058032.3  Farnesyl pyrophosphate synthase CG12389-RA (Fpps), mRNA 
13  NM_057826.3  rho-type guanine exchange factor CG10043-RA, transcript variant A (rtGEF), mRNA 
13  NM_165327.1  rho-type guanine exchange factor CG10043-RB, transcript variant B (rtGEF), mRNA 
NM_080167.3  Male-specific RNA 57Da CG9074-RA (Mst57Da), mRNA 
NM_140841.2  CG9666-RA (CG9666), mRNA 
NM_141524.1  CG9626-RA (CG9626), mRNA 
NM_167302.1  Transport and Golgi organization CG1841-RB, transcript variant B (Tango10), mRNA 
NM_132515.2  Transport and Golgi organization CG1841-RA, transcript variant A (Tango10), mRNA 
NM_001014571.1  formin 3 CG33556-RA (form3), mRNA 
NM_141397.2  CG1021-RB, transcript variant B (CG1021), mRNA 
NM_169141.1  CG1021-RA, transcript variant A (CG1021), mRNA 
NM_168293.1  CG32030-RA, transcript variant A (CG32030), mRNA 
NM_168294.1  CG32030-RB, transcript variant B (CG32030), mRNA 
NM_079546.2  mitochondrial ribosomal protein S9 CG2957-RA (mRpS9), mRNA 
NM_164608.1  CG8892-RC, transcript variant C (CG8892), mRNA 
NM_164607.1  CG8892-RB, transcript variant B (CG8892), mRNA 
NM_139790.1  CG8270-RA (CG8270), mRNA 
NM_142187.2  CG14866-RA (CG14866), mRNA 
12  NM_132116.1  CG14441-RA (CG14441), mRNA 
NM_139602.2  Ack CG14992-RA (Ack), mRNA 
NM_136397.1  CG15236-RA, transcript variant A (CG15236), mRNA 
NM_165493.1  CG15236-RB, transcript variant B (CG15236), mRNA 
NM_142215.2  CG5205-RA (CG5205), mRNA 
NM_132061.1  CG5937-RA (CG5937), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.