National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14517R-1 
 Symbol beta4GalNAcTB  Full Name beta4GalNAcTB 
 CG No CG14517  Old CG No CG14517 
 Synonyms CG14517, dbeta4GalTB, beta4GalTB, beta4GalNAcTB 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGTTCGTGCGGCTCTGGGTC 
 Primer Seq. 3'
aatctagaggtaccACCTGGGCGCCAATGTTGAAGAGCAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGTTCGTGC GGCTCTGGGT CCG-AGCTTC CATAAATATG ATCTTCTCAT CGCCATCGGA 
0061 CTGATCACTC TCATCGTGTA CCTGTGTCTG CCCTTCCGGT TCGCATCGCA CTACGACTAC 
0121 ATCGAGGAAT CAAAGATCGA GGGGGCTCTG GTGCCGCAGG TGACCAGAAA TGTCTCCCAG 
0181 CAGGAAGTTT TCGAATGCAC CTACTCGGAG ATCATTGCCG AAAACCGGTT CGTCTACCAC 
0241 CTGGCCCATT ACCATGACGC GGTGCAGAGG GGCGCGGAGA TCCGTCCTGG CGGCGAGTTC 
0301 CGTCCGGAAG GATGTCAGGC TCGCTACAGC ACCGCCATCA TTGTGCCGTA CAGGCAGCGG 
0361 GAGGAGCAGC TGCACGCCTT CCTCACGTAC ATGCACAATT ACCTGCCGCA GCAGCTGATC 
0421 CACTATCGGA TTTTCCTGGT CGAACAGTTC GATCATAAGC CGTTTAACAG GGCGATGCTC 
0481 TTCAACATTG GCGCCCAGGT GG 
 in silico PCR Fragment
0001 atgttcgtgc ggctctgggt ccgcagcttc cataaatatg atcttctcat cgccatcgga 
0061 ctgatcactc tcatcgtgta cctgtgtctg cccttccggt tcgcatcgca ctacgactac 
0121 atcgaggaat caaagatcga gggggctctg gtgccgcagg tgaccagaaa tgtctcccag 
0181 caggaagttt tcgaatgcac ctactcggag atcattgccg aaaaccggtt cgtctaccac 
0241 ctggcccatt accatgacgc ggtgcagagg ggcgcggaga tccgtcctgg cggcgagttc 
0301 cgtccggaag gatgtcaggc tcgctacagc accgccatca ttgtgccgta caggcagcgg 
0361 gaggagcagc tgcacgcctt cctcacgtac atgcacaatt acctgccgca gcagctgatc 
0421 cactatcgga ttttcctggt cgaacagttc gatcataagc cgtttaacag ggcgatgctc 
0481 ttcaacattg gcgcccaggt  
 Assemble Data

14517R-1.IR full       1   ATGTTCGTGCGGCTCTGGGTCCG-AGCTTCCATAAATATGATCTTCTCATCGCCATCGGA 60
                           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
14517R-1.in silico     1   ATGTTCGTGCGGCTCTGGGTCCGCAGCTTCCATAAATATGATCTTCTCATCGCCATCGGA 60


14517R-1.IR full       61  CTGATCACTCTCATCGTGTACCTGTGTCTGCCCTTCCGGTTCGCATCGCACTACGACTAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14517R-1.in silico     61  CTGATCACTCTCATCGTGTACCTGTGTCTGCCCTTCCGGTTCGCATCGCACTACGACTAC 120


14517R-1.IR full       121 ATCGAGGAATCAAAGATCGAGGGGGCTCTGGTGCCGCAGGTGACCAGAAATGTCTCCCAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14517R-1.in silico     121 ATCGAGGAATCAAAGATCGAGGGGGCTCTGGTGCCGCAGGTGACCAGAAATGTCTCCCAG 180


14517R-1.IR full       181 CAGGAAGTTTTCGAATGCACCTACTCGGAGATCATTGCCGAAAACCGGTTCGTCTACCAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14517R-1.in silico     181 CAGGAAGTTTTCGAATGCACCTACTCGGAGATCATTGCCGAAAACCGGTTCGTCTACCAC 240


14517R-1.IR full       241 CTGGCCCATTACCATGACGCGGTGCAGAGGGGCGCGGAGATCCGTCCTGGCGGCGAGTTC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14517R-1.in silico     241 CTGGCCCATTACCATGACGCGGTGCAGAGGGGCGCGGAGATCCGTCCTGGCGGCGAGTTC 300


14517R-1.IR full       301 CGTCCGGAAGGATGTCAGGCTCGCTACAGCACCGCCATCATTGTGCCGTACAGGCAGCGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14517R-1.in silico     301 CGTCCGGAAGGATGTCAGGCTCGCTACAGCACCGCCATCATTGTGCCGTACAGGCAGCGG 360


14517R-1.IR full       361 GAGGAGCAGCTGCACGCCTTCCTCACGTACATGCACAATTACCTGCCGCAGCAGCTGATC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14517R-1.in silico     361 GAGGAGCAGCTGCACGCCTTCCTCACGTACATGCACAATTACCTGCCGCAGCAGCTGATC 420


14517R-1.IR full       421 CACTATCGGATTTTCCTGGTCGAACAGTTCGATCATAAGCCGTTTAACAGGGCGATGCTC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14517R-1.in silico     421 CACTATCGGATTTTCCTGGTCGAACAGTTCGATCATAAGCCGTTTAACAGGGCGATGCTC 480


14517R-1.IR full       481 TTCAACATTGGCGCCCAGGTGG 502
                           ||||||||||||||||||||  
14517R-1.in silico     481 TTCAACATTGGCGCCCAGGT-- 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_143400.1  beta4GalNAcTB CG14517-RA (beta4GalNAcTB), mRNA 
0.2  NM_135211.2  Organic anion transporting polypeptide 26F CG31634-RA (Oatp26F), mRNA 
NM_143325.2  CG12876-RA (CG12876), mRNA 
NM_137008.1  CG4670-RA (CG4670), mRNA 
NM_057473.3  tamas CG8987-RA (tam), mRNA 
NM_166335.2  CG7097-RA, transcript variant A (CG7097), mRNA 
NM_058032.3  Farnesyl pyrophosphate synthase CG12389-RA (Fpps), mRNA 
13  NM_057826.3  rho-type guanine exchange factor CG10043-RA, transcript variant A (rtGEF), mRNA 
13  NM_165327.1  rho-type guanine exchange factor CG10043-RB, transcript variant B (rtGEF), mRNA 
NM_080167.3  Male-specific RNA 57Da CG9074-RA (Mst57Da), mRNA 
NM_140841.2  CG9666-RA (CG9666), mRNA 
NM_141524.1  CG9626-RA (CG9626), mRNA 
NM_167302.1  Transport and Golgi organization CG1841-RB, transcript variant B (Tango10), mRNA 
NM_132515.2  Transport and Golgi organization CG1841-RA, transcript variant A (Tango10), mRNA 
NM_001014571.1  formin 3 CG33556-RA (form3), mRNA 
NM_141397.2  CG1021-RB, transcript variant B (CG1021), mRNA 
NM_169141.1  CG1021-RA, transcript variant A (CG1021), mRNA 
NM_168293.1  CG32030-RA, transcript variant A (CG32030), mRNA 
NM_168294.1  CG32030-RB, transcript variant B (CG32030), mRNA 
NM_079546.2  mitochondrial ribosomal protein S9 CG2957-RA (mRpS9), mRNA 
NM_164608.1  CG8892-RC, transcript variant C (CG8892), mRNA 
NM_164607.1  CG8892-RB, transcript variant B (CG8892), mRNA 
NM_139790.1  CG8270-RA (CG8270), mRNA 
NM_142187.2  CG14866-RA (CG14866), mRNA 
12  NM_132116.1  CG14441-RA (CG14441), mRNA 
NM_139602.2  Ack CG14992-RA (Ack), mRNA 
NM_136397.1  CG15236-RA, transcript variant A (CG15236), mRNA 
NM_165493.1  CG15236-RB, transcript variant B (CG15236), mRNA 
NM_142215.2  CG5205-RA (CG5205), mRNA 
NM_132061.1  CG5937-RA (CG5937), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.