National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14512R-3 
 Symbol CG14512  Full Name CG14512 
 CG No CG14512  Old CG No CG14512 
 Synonyms CG14512 
 Accession No (Link to NCBI) NM_143416.1 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTATCAACTGCATCCACGGAAC 
 Primer Seq. 3'
aatctagaggtaccGACATCAGCTGATTGATGGCG 
 Predicted Fragment Size
454 
 IR fragment full Seq
0001 TATCAACTGC ATCCACGGAA CCCGCACTCA AAGCTCTACA GAACCGGAAA TGCACCAAAC 
0061 TCGTCATACA GCACGGAAAT TCGCAACCAT TAACAGACGA TGAAATACAA TTGATAAGAA 
0121 AAAACTACGG AATCCAGATA GAGCAGTACA ATTTCCGGCC AAATACGGAG GACATCAAGT 
0181 CCGCAGACCT AATTATTGGA CATGCGGGAG CCGGAACTTG CATGGATATA CTAAATAACC 
0241 AGAAACCTGG ACTCATTGTG ATAAATGACA CGCTCATGGA CAATCATCAA CTGGAGTTGG 
0301 CCAAGCAACT GGCCGCTGAA AACTATCTGT ATTACTGCAA AGTTACCGAC GTGGATGCCC 
0361 AGCTAGCTAC TCTGGACTTT GAAGCCTTAA AGCCCTATGA AACGAAACCG GAAAATCTTA 
0421 GCAAATTCGT TTCCGCCATC AATCAGCTGA TGTC 
 in silico PCR Fragment
0001 TATCAACTGC ATCCACGGAA CCCGCACTCA AAGCTCTACA GAACCGGAAA TGCACCAAAC 
0061 TCGTCATACA GCACGGAAAT TCGCAACCAT TAACAGACGA TGAAATACAA TTGATAAGAA 
0121 AAAACTACGG AATCCAGATA GAGCAGTACA ATTTCCGGCC AAATACGGAG GACATCAAGT 
0181 CCGCAGACCT AATTATTGGA CATGCGGGAG CCGGAACTTG CATGGATATA CTAAATAACC 
0241 AGAAACCTGG ACTCATTGTG ATAAATGACA CGCTCATGGA CAATCATCAA CTGGAGTTGG 
0301 CCAAGCAACT GGCCGCTGAA AACTATCTGT ATTACTGCAA AGTTACCGAC GTGGATGCCC 
0361 AGCTAGCTAC TCTGGACTTT GAAGCCTTAA AGCCCTATGA AACGAAACCG GAAAATCTTA 
0421 GCAAATTCGT TTCCGCCATC AATCAGCTGA TGTC 
 Assemble Data

14512R-3.IR_full       1   TATCAACTGCATCCACGGAACCCGCACTCAAAGCTCTACAGAACCGGAAATGCACCAAAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14512R-3.in silico     1   TATCAACTGCATCCACGGAACCCGCACTCAAAGCTCTACAGAACCGGAAATGCACCAAAC 60


14512R-3.IR_full       61  TCGTCATACAGCACGGAAATTCGCAACCATTAACAGACGATGAAATACAATTGATAAGAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14512R-3.in silico     61  TCGTCATACAGCACGGAAATTCGCAACCATTAACAGACGATGAAATACAATTGATAAGAA 120


14512R-3.IR_full       121 AAAACTACGGAATCCAGATAGAGCAGTACAATTTCCGGCCAAATACGGAGGACATCAAGT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14512R-3.in silico     121 AAAACTACGGAATCCAGATAGAGCAGTACAATTTCCGGCCAAATACGGAGGACATCAAGT 180


14512R-3.IR_full       181 CCGCAGACCTAATTATTGGACATGCGGGAGCCGGAACTTGCATGGATATACTAAATAACC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14512R-3.in silico     181 CCGCAGACCTAATTATTGGACATGCGGGAGCCGGAACTTGCATGGATATACTAAATAACC 240


14512R-3.IR_full       241 AGAAACCTGGACTCATTGTGATAAATGACACGCTCATGGACAATCATCAACTGGAGTTGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14512R-3.in silico     241 AGAAACCTGGACTCATTGTGATAAATGACACGCTCATGGACAATCATCAACTGGAGTTGG 300


14512R-3.IR_full       301 CCAAGCAACTGGCCGCTGAAAACTATCTGTATTACTGCAAAGTTACCGACGTGGATGCCC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14512R-3.in silico     301 CCAAGCAACTGGCCGCTGAAAACTATCTGTATTACTGCAAAGTTACCGACGTGGATGCCC 360


14512R-3.IR_full       361 AGCTAGCTACTCTGGACTTTGAAGCCTTAAAGCCCTATGAAACGAAACCGGAAAATCTTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14512R-3.in silico     361 AGCTAGCTACTCTGGACTTTGAAGCCTTAAAGCCCTATGAAACGAAACCGGAAAATCTTA 420


14512R-3.IR_full       421 GCAAATTCGTTTCCGCCATCAATCAGCTGATGTC 454
                           ||||||||||||||||||||||||||||||||||
14512R-3.in silico     421 GCAAATTCGTTTCCGCCATCAATCAGCTGATGTC 454

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   436  NM_143416.1  CG14512-RA (CG14512), mRNA 
0   NM_132305.1  CG12115-RA (CG12115), mRNA 
0   NM_136600.1  CG13743-RA (CG13743), mRNA 
0   NM_169750.2  CG31266-RA (CG31266), mRNA 
0   NM_137571.1  CG9416-RA (CG9416), mRNA 
0   NM_168278.1  CG32352-RB, transcript variant B (CG32352), mRNA 
0   NM_168279.2  CG32352-RA, transcript variant A (CG32352), mRNA 
0   NM_170629.2  CG32352-RC, transcript variant C (CG32352), mRNA 
0   NM_143742.2  CG5812-RA (GCR(ich)), mRNA 
0   NM_140859.1  CG9472-RA (CG9472), mRNA 
0   NM_079263.2  CG5263-RA, transcript variant A (smg), mRNA 
0   NM_168309.1  CG5263-RB, transcript variant B (smg), mRNA 
0   NM_168310.1  CG5263-RC, transcript variant C (smg), mRNA 
0   NM_170029.1  CG31161-RA (CG31161), mRNA 
0   13  NM_205876.1  CG32019-RC, transcript variant C (bt), mRNA 
0   13  NM_205875.1  CG32019-RE, transcript variant E (bt), mRNA 
0   13  NM_205877.1  CG32019-RD, transcript variant D (bt), mRNA 
0   13  NM_166790.2  CG32019-RA, transcript variant A (bt), mRNA 
0   10  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_001038916.1  CG17689-RB, transcript variant B (CG17689), mRNA 
0   NM_140402.2  CG17689-RA, transcript variant A (CG17689), mRNA 
0   NM_142495.1  CG14299-RA, transcript variant A (CG14299), mRNA 
0   NM_001014640.1  CG14299-RB, transcript variant B (CG14299), mRNA 
0   NM_143306.2  CG13977-RA (Cyp6a18), mRNA 
0   NM_057805.2  CG9660-RA, transcript variant A (toc), mRNA 
0   NM_130557.2  CG14786-RA (CG14786), mRNA 
0   NM_079866.2  CG1744-RA (chp), mRNA 
0   NM_057378.2  CG4200-RA (sl), mRNA 
0   NM_130591.2  CG14814-RB, transcript variant B (CG14814), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.