National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14512R-1 
 Symbol CG14512  Full Name CG14512 
 CG No CG14512  Old CG No CG14512 
 Synonyms CG14512 
 Accession No (Link to NCBI) NM_143416.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TATCAACTGCATCCACGGAACCCGCACTCAAAGCTCTACAGAACCGGAAATGCACCAAAC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TCGTCATACAGCACGGAAATTCGCAACCATTAACAGACGATGAAATACAATTGATAAGAA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAAACTACGGAATCCAGATAGAGCAGTACAATTTCCGGCCAAATACGGAGGACATCAAGT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCGCAGACCTAATTATTGGACATGCGGGAGCCGGAACTTGCATGGATATACTAAATAACC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGAAACCTGGACTCATTGTGATAAATGACACGCTCATGGACAATCATCAACTGGAGTTGG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCAAGCAACTGGCCGCTGAAAACTATCTGTATTACTGCAAAGTTACCGACGTGGATGCCC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGCTAGCTACTCTGGACTTTGAAGCCTTAAAGCCCTATGAAACGAAACCGGAAAATCTTA 420

                           |||||||||||||||||||||||||||||||||| silico     421 GCAAATTCGTTTCCGCCATCAATCAGCTGATGTC 454

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   436  NM_143416.1  CG14512-RA (CG14512), mRNA 
0   NM_132305.1  CG12115-RA (CG12115), mRNA 
0   NM_136600.1  CG13743-RA (CG13743), mRNA 
0   NM_169750.2  CG31266-RA (CG31266), mRNA 
0   NM_137571.1  CG9416-RA (CG9416), mRNA 
0   NM_168278.1  CG32352-RB, transcript variant B (CG32352), mRNA 
0   NM_168279.2  CG32352-RA, transcript variant A (CG32352), mRNA 
0   NM_170629.2  CG32352-RC, transcript variant C (CG32352), mRNA 
0   NM_143742.2  CG5812-RA (GCR(ich)), mRNA 
0   NM_140859.1  CG9472-RA (CG9472), mRNA 
0   NM_079263.2  CG5263-RA, transcript variant A (smg), mRNA 
0   NM_168309.1  CG5263-RB, transcript variant B (smg), mRNA 
0   NM_168310.1  CG5263-RC, transcript variant C (smg), mRNA 
0   NM_170029.1  CG31161-RA (CG31161), mRNA 
0   13  NM_205876.1  CG32019-RC, transcript variant C (bt), mRNA 
0   13  NM_205875.1  CG32019-RE, transcript variant E (bt), mRNA 
0   13  NM_205877.1  CG32019-RD, transcript variant D (bt), mRNA 
0   13  NM_166790.2  CG32019-RA, transcript variant A (bt), mRNA 
0   10  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_001038916.1  CG17689-RB, transcript variant B (CG17689), mRNA 
0   NM_140402.2  CG17689-RA, transcript variant A (CG17689), mRNA 
0   NM_142495.1  CG14299-RA, transcript variant A (CG14299), mRNA 
0   NM_001014640.1  CG14299-RB, transcript variant B (CG14299), mRNA 
0   NM_143306.2  CG13977-RA (Cyp6a18), mRNA 
0   NM_057805.2  CG9660-RA, transcript variant A (toc), mRNA 
0   NM_130557.2  CG14786-RA (CG14786), mRNA 
0   NM_079866.2  CG1744-RA (chp), mRNA 
0   NM_057378.2  CG4200-RA (sl), mRNA 
0   NM_130591.2  CG14814-RB, transcript variant B (CG14814), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.