National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1444R-2 
 Symbol CG1444  Full Name CG1444 
 CG No CG1444  Old CG No CG1444 
 Synonyms CG1444 
 Accession No (Link to NCBI) NM_132192.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Cinnamon E, Makki R, Sawala A, Wickenberg LP, Blomquist GJ, Tittiger C, Paroush Z, Gould AP.
Drosophila Spidey/Kar Regulates Oenocyte Growth via PI3-Kinase Signaling.
PLoS Genet. (2016) 12(8) e1006154 [ PubMed ID = 27500738 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTCCTCGGTGGATCTCTCCAA 
 Primer Seq. 3'
aatctagaggtaccTGGTGGAACTGTACACGCTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTCCTCGGTG GATCTCTCCA AAATGGGCGA GTGGGCAGTT GTCACCGGGT CGACCGATGG 
0061 AATTGGCAAG GNCTACGCCA AGGAGTTGGC TCGCAGGGGC TTGAAACTGG TGCTGATTAG 
0121 TAGATCCCTG GAGAAACTGA ATGTGGTGGC CAAGGAGATA GGCGATAAAT ACGGTGTGGA 
0181 GGTGCGTGTG ATCGATGTGG ACTTTCACCG GCGGTGACGA GATCTACGAT AAGATCCGCG 
0241 AAAAGACCAC TGGCCTCAAT GTCGGAGTGC TGGTCAACAA CGTGGGCATC AGCTACGGCC 
0301 ATCCCGAGTA CTTTCTGGAC TGCTACAAAG CCGATCCCCC ATTCCTGCGC AACATTGTGG 
0361 CTGCCAATAT CCACTCGGTG ACGCACATGA CCGCACTTTT TCTACCCGGC ATGATTAGCC 
0421 AGCGACGTGG TGTGATCATA AATGTATCGT CCACCGCCGG AGTCATTCCT AATCCGCTGC 
0481 TGAGCGTGTA CAGTTCCACC A 
 in silico PCR Fragment
0001 CTCCTCGGTG GATCTCTCCA AAATGGGCGA GTGGGCAGTT GTCACCGGGT CGACCGATGG 
0061 AATTGGCAAG GCCTACGCCA AGGAGTTGGC TCGCAGGGGC TTGAAACTGG TGCTGATTAG 
0121 TAGATCCCTG GAGAAACTGA ATGTGGTGGC CAAGGAGATA GGCGATAAAT ACGGTGTGGA 
0181 GGTGCGTGTG ATCGATGTGG AC-TTCACCG GCGGTGACGA GATCTACGAT AAGATCCGCG 
0241 AAAAGACCAC TGGCCTCAAT GTCGGAGTGC TGGTCAACAA CGTGGGCATC AGCTACGGCC 
0301 ATCCCGAGTA CTTTCTGGAC TGCTACAAAG CCGATCCCCC ATTCCTGCGC AACATTGTGG 
0361 CTGCCAATAT CCACTCGGTG ACGCACATGA CCGCACTTTT TCTACCCGGC ATGATTAGCC 
0421 AGCGACGTGG TGTGATCATA AATGTATCGT CCACCGCCGG AGTCATTCCT AATCCGCTGC 
0481 TGAGCGTGTA CAGTTCCACC A 
 Assemble Data

1444R-2.IR_full        1   TCCTCGGTGGATCTCTCCAAAATGGGCGAGTGGGCAGTTGTCACCGGGTCGACCGATGG 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1444R-2.in silico      1   TCCTCGGTGGATCTCTCCAAAATGGGCGAGTGGGCAGTTGTCACCGGGTCGACCGATGG 59


1444R-2.IR_full       61  AATTGGCAAGGNCTACGCCAAGGAGTTGGCTCGCAGGGGCTTGAAACTGGTGCTGATTAG 119
                          ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
1444R-2.in silico     61  AATTGGCAAGGCCTACGCCAAGGAGTTGGCTCGCAGGGGCTTGAAACTGGTGCTGATTAG 119


1444R-2.IR_full       121 TAGATCCCTGGAGAAACTGAATGTGGTGGCCAAGGAGATAGGCGATAAATACGGTGTGGA 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1444R-2.in silico     121 TAGATCCCTGGAGAAACTGAATGTGGTGGCCAAGGAGATAGGCGATAAATACGGTGTGGA 179


1444R-2.IR_full       181 GGTGCGTGTGATCGATGTGGACTTTCACCGGCGGTGACGAGATCTACGATAAGATCCGCG 239
                          |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
1444R-2.in silico     181 GGTGCGTGTGATCGATGTGGAC-TTCACCGGCGGTGACGAGATCTACGATAAGATCCGCG 239


1444R-2.IR_full       241 AAAAGACCACTGGCCTCAATGTCGGAGTGCTGGTCAACAACGTGGGCATCAGCTACGGCC 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1444R-2.in silico     241 AAAAGACCACTGGCCTCAATGTCGGAGTGCTGGTCAACAACGTGGGCATCAGCTACGGCC 299


1444R-2.IR_full       301 ATCCCGAGTACTTTCTGGACTGCTACAAAGCCGATCCCCCATTCCTGCGCAACATTGTGG 359
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1444R-2.in silico     301 ATCCCGAGTACTTTCTGGACTGCTACAAAGCCGATCCCCCATTCCTGCGCAACATTGTGG 359


1444R-2.IR_full       361 CTGCCAATATCCACTCGGTGACGCACATGACCGCACTTTTTCTACCCGGCATGATTAGCC 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1444R-2.in silico     361 CTGCCAATATCCACTCGGTGACGCACATGACCGCACTTTTTCTACCCGGCATGATTAGCC 419


1444R-2.IR_full       421 AGCGACGTGGTGTGATCATAAATGTATCGTCCACCGCCGGAGTCATTCCTAATCCGCTGC 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1444R-2.in silico     421 AGCGACGTGGTGTGATCATAAATGTATCGTCCACCGCCGGAGTCATTCCTAATCCGCTGC 479


1444R-2.IR_full       481 TGAGCGTGTACAGTTCCACCA 500
                          |||||||||||||||||||||
1444R-2.in silico     481 TGAGCGTGTACAGTTCCACCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132192.1  CG1444-RA (CG1444), mRNA 
0.2   10  20  NM_135972.2  CG13284-RA, transcript variant A (CG13284), mRNA 
0.2   10  20  NM_165197.2  CG13284-RB, transcript variant B (CG13284), mRNA 
0   NM_206765.1  CG18572-RB, transcript variant B (r), mRNA 
0   NM_078653.1  CG18572-RA, transcript variant A (r), mRNA 
0   NM_079700.1  CG3723-RA (Dhc93AB), mRNA 
0   NM_137070.1  CG16935-RA (CG16935), mRNA 
0   NM_143012.1  CG5789-RA (CG5789), mRNA 
0   NM_140500.2  CG6878-RA (CG6878), mRNA 
0   NM_137257.1  CG7786-RA (CG7786), mRNA 
0   15  NM_135973.1  CG6012-RA (CG6012), mRNA 
0   NM_057949.3  CG10270-RA (D19B), mRNA 
0   NM_132025.2  CG3125-RA, transcript variant A (l(1)G0060), mRNA 
0   NM_167047.1  CG3125-RB, transcript variant B (l(1)G0060), mRNA 
0   NM_136866.2  CG8983-RB, transcript variant B (ERp60), mRNA 
0   NM_165849.1  CG8983-RA, transcript variant A (ERp60), mRNA 
0   NM_132069.2  CG32754-RA (vanin-like), mRNA 
0   NM_132206.1  CG2253-RA (Upf2), mRNA 
0   NM_170472.1  CG31028-RB, transcript variant B (CG31028), mRNA 
0   NM_170473.1  CG31028-RA, transcript variant A (CG31028), mRNA 
0   NM_141805.1  CG5207-RA (scpr-A), mRNA 
0   13  31  NM_140518.1  CG7439-RB, transcript variant B (AGO2), mRNA 
0   13  31  NM_168626.1  CG7439-RC, transcript variant C (AGO2), mRNA 
0   16  NM_165198.1  CG31810-RA (CG31810), mRNA 
0   15  NM_165199.1  CG31809-RA (CG31809), mRNA 
0   NM_132518.1  CG9360-RA (CG9360), mRNA 
0   NM_141232.1  CG9769-RA (CG9769), mRNA 
0   NM_140408.2  CG8745-RA (CG8745), mRNA 
0   NM_132036.1  CG15767-RA (CG15767), mRNA 
0   NM_167150.1  CG2151-RC, transcript variant C (Trxr-1), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.