National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14228R-2 
 Symbol Mer  Full Name Merlin 
 CG No CG14228  Old CG No CG14228 
 Synonyms BG01543, CG14228, Mer, Dmerlin, EMR2, Emr2, mer 
 Accession No (Link to NCBI) NM_078689.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Jiménez-Martínez M, Ostalé CM, van der Burg LR, Galán-Martínez J, Hardwick JCH, López-Pérez R, Hawinkels LJAC, Stamatakis K, Fresno M.
DUSP10 Is a Regulator of YAP1 Activity Promoting Cell Proliferation and Colorectal Cancer Progression.
Cancers (Basel) (2019) 11(11) [ PubMed ID = 31717606 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACGACTACGAGACCTACAAGG 
 Primer Seq. 3'
aatctagaggtaccGCTGGATTTCCATGGTGTCGG 
 Predicted Fragment Size
501 
 IR fragment full Seq
0001 ACGACTACGA GAcCTACAAG GACGGTATGC TGGCCGGGGG TGAGCTTCTG CCCAAGGGAG 
0061 TGACCGATCA GTACCAGATG ACGCCCGAAA TGTGGGAGGA ACGGATCAAG ACATGGTACA 
0121 TGGACCATGA GCCCATGACG CGCGACGAGG TGGAGATGGA GTACCTGAAG ATTGCTCAGG 
0181 ACCTGGACAT GTACGGAGTA AACTACTTTC CTATTACGAA TAAGAACAAA ACCAAATTGT 
0241 GGCTGGGCGT CACCTCCGTG GGCCTAAACA TCTACGATGA GCGCGATAAG NTAACGCCAA 
0301 AGACAACGTT CCAGTGGAAC GAGNATACGG CACGTCAGCT TCGACGACAA GAAGTTCACC 
0361 ATTCGCCTGG TGGATGCCAA GGTTTCGAAT TTCATCTTTT ACTCGCAGGA CCTCCACATC 
0421 AACAAAATGA TTCTTGACCT GTGCAAGGGC AATCACGATC TATATATGCG CCGCCGCAAA 
0481 CCCGACACCA TGGAAATCCA GC 
 in silico PCR Fragment
0001 ACGACTACGA GACCTACAAG GACGGTATGC TGGCCGGGGG TGAGCTTCTG CCCAAGGGAG 
0061 TGACCGATCA GTACCAGATG ACGCCCGAAA TGTGGGAGGA ACGGATCAAG ACATGGTACA 
0121 TGGACCATGA GCCCATGACG CGCGACGAGG TGGAGATGGA GTACCTGAAG ATTGCTCAGG 
0181 ACCTGGACAT GTACGGAGTA AACTACTTTC CTATTACGAA TAAGAACAAA ACCAAATTGT 
0241 GGCTGGGCGT CACCTCCGTG GGCCTAAACA TCTACGATGA GCGCGATAAG CTAACGCCAA 
0301 AGACAACGTT CCAGTGGAAC GAG-ATACGG CACGTCAGCT TCGACGACAA GAAGTTCACC 
0361 ATTCGCCTGG TGGATGCCAA GGTTTCGAAT TTCATCTTTT ACTCGCAGGA CCTCCACATC 
0421 AACAAAATGA TTCTTGACCT GTGCAAGGGC AATCACGATC TATATATGCG CCGCCGCAAA 
0481 CCCGACACCA TGGAAATCCA GC 
 Assemble Data

14228R-2.IR_full       1   ACGACTACGAGACCTACAAGGACGGTATGCTGGCCGGGGGTGAGCTTCTGCCCAAGGGAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14228R-2.in silico     1   ACGACTACGAGACCTACAAGGACGGTATGCTGGCCGGGGGTGAGCTTCTGCCCAAGGGAG 60


14228R-2.IR_full       61  TGACCGATCAGTACCAGATGACGCCCGAAATGTGGGAGGAACGGATCAAGACATGGTACA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14228R-2.in silico     61  TGACCGATCAGTACCAGATGACGCCCGAAATGTGGGAGGAACGGATCAAGACATGGTACA 120


14228R-2.IR_full       121 TGGACCATGAGCCCATGACGCGCGACGAGGTGGAGATGGAGTACCTGAAGATTGCTCAGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14228R-2.in silico     121 TGGACCATGAGCCCATGACGCGCGACGAGGTGGAGATGGAGTACCTGAAGATTGCTCAGG 180


14228R-2.IR_full       181 ACCTGGACATGTACGGAGTAAACTACTTTCCTATTACGAATAAGAACAAAACCAAATTGT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14228R-2.in silico     181 ACCTGGACATGTACGGAGTAAACTACTTTCCTATTACGAATAAGAACAAAACCAAATTGT 240


14228R-2.IR_full       241 GGCTGGGCGTCACCTCCGTGGGCCTAAACATCTACGATGAGCGCGATAAGNTAACGCCAA 300
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
14228R-2.in silico     241 GGCTGGGCGTCACCTCCGTGGGCCTAAACATCTACGATGAGCGCGATAAGCTAACGCCAA 300


14228R-2.IR_full       301 AGACAACGTTCCAGTGGAACGAGNATACGGCACGTCAGCTTCGACGACAAGAAGTTCACC 360
                           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
14228R-2.in silico     301 AGACAACGTTCCAGTGGAACGAG-ATACGGCACGTCAGCTTCGACGACAAGAAGTTCACC 360


14228R-2.IR_full       361 ATTCGCCTGGTGGATGCCAAGGTTTCGAATTTCATCTTTTACTCGCAGGACCTCCACATC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14228R-2.in silico     361 ATTCGCCTGGTGGATGCCAAGGTTTCGAATTTCATCTTTTACTCGCAGGACCTCCACATC 420


14228R-2.IR_full       421 AACAAAATGATTCTTGACCTGTGCAAGGGCAATCACGATCTATATATGCGCCGCCGCAAA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14228R-2.in silico     421 AACAAAATGATTCTTGACCTGTGCAAGGGCAATCACGATCTATATATGCGCCGCCGCAAA 480


14228R-2.IR_full       481 CCCGACACCATGGAAATCCAGC 502
                           ||||||||||||||||||||||
14228R-2.in silico     481 CCCGACACCATGGAAATCCAGC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   483  NM_078689.2  CG14228-RA (Mer), mRNA 
0   NM_140997.2  CG11399-RB (CG11399), mRNA 
0   NM_165597.1  CG8705-RB, transcript variant B (pnut), mRNA 
0   NM_057716.3  CG8705-RA, transcript variant A (pnut), mRNA 
0   NM_078569.2  CG1554-RA (RpII215), mRNA 
0   NM_141800.1  CG14701-RA (CG14701), mRNA 
0   NM_001031865.1  CG33950-RB, transcript variant B (trol), mRNA 
0   NM_001031863.1  CG33950-RD, transcript variant D (trol), mRNA 
0   NM_001031866.1  CG33950-RA, transcript variant A (trol), mRNA 
0   NM_001031864.1  CG33950-RE, transcript variant E (trol), mRNA 
0   NM_001031862.1  CG33950-RC, transcript variant C (trol), mRNA 
0   NM_001031867.1  CG33950-RF, transcript variant F (trol), mRNA 
0   NM_135937.2  CG4930-RA (CG4930), mRNA 
0   NM_142276.2  CG17930-RA (CG17930), mRNA 
0   NM_132236.3  CG32717-RA, transcript variant A (sdt), mRNA 
0   NM_206653.1  CG32717-RE, transcript variant E (sdt), mRNA 
0   NM_132235.2  CG32717-RB, transcript variant B (sdt), mRNA 
0   NM_143422.1  CG11898-RA (CG11898), mRNA 
0   NM_079355.2  CG6988-RA, transcript variant A (Pdi), mRNA 
0   NM_168614.2  CG6988-RD, transcript variant D (Pdi), mRNA 
0   NM_132932.2  CG9634-RA (CG9634), mRNA 
0   NM_057949.3  CG10270-RA (D19B), mRNA 
0   NM_170447.1  CG31038-RA, transcript variant A (CG31038), mRNA 
0   NM_206584.1  CG31038-RF, transcript variant F (CG31038), mRNA 
0   NM_206585.1  CG31038-RE, transcript variant E (CG31038), mRNA 
0   NM_166350.1  CG9325-RD, transcript variant D (hts), mRNA 
0   NM_206586.1  CG31038-RC, transcript variant C (CG31038), mRNA 
0   13  40  NM_206667.1  CG10701-RG, transcript variant G (Moe), mRNA 
0   13  40  NM_206668.1  CG10701-RF, transcript variant F (Moe), mRNA 
0   13  40  NM_206666.1  CG10701-RH, transcript variant H (Moe), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.