National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14026R-1 
 Symbol tkv  Full Name thickveins 
 CG No CG14026  Old CG No CG14026 
 Synonyms tkv, Tkv, TKV, CG14026, Brk25D2, Brk25D1, dtfr, Atkv, l(2)04415, str, Brk25D, l(2)25Da, STK-A, Dtfr, Atr25D, tkv1 
 Accession No (Link to NCBI) NM_175975.1 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Li Z, Zhang Y, Han L, Shi L, Lin X.
Trachea-derived dpp controls adult midgut homeostasis in Drosophila.
Dev. Cell (2013) 24(2) 133-43 [ PubMed ID = 23369712 ] [ RRC reference ]

Ma H, Zhao H, Liu F, Zhao H, Kong R, Shi L, Wei M, Li Z.
Heparan sulfate negatively regulates intestinal stem cell proliferation in Drosophila adult midgut.
Biol Open (2019) 8(10) [ PubMed ID = 31628141 ] [ RRC reference ]

Xu R, Li J, Zhao H, Kong R, Wei M, Shi L, Bai G, Li Z.
Self-restrained regulation of stem cell niche activity by niche components in the Drosophila testis.
Dev. Biol. (2018) 439(1) 42-51 [ PubMed ID = 29679558 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGTGCGAATGTTCAGCCAGAC 
 Primer Seq. 3'
aatctagaggtaccGAGATGATGATGGAGCCAAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGTGCGAATG TTCAGCCAGA CGTCGAAGCT ATGGCCGCCG CCGCTTTGAG TGGCATGGAA 
0061 ATGGGATCTG GACCAGGATC AGAGGGATAT GAGGATGCCG ACAACGAGAA AAGCAAGACC 
0121 GTGGAAAATG CCCGCTCCCT AACCTGCTAC TGCGATGGCA GTTGTCCGGA CAATGTAAGC 
0181 AATGGAACCT GCGAGACCAG ACCCGGTGGC AGTTGCNTTC AGCGCAGTCC AACAGCTTTA 
0241 CGATGAGACG ACCGGGATGT ACGAGGAGGA GCGTACATAT GGATGCATGC CTCCCGAAGA 
0301 CAACGGTGGT TTTCTCATGT GCAAGGTAGC CGCTGTACCC CACCTGCATG GCAAGAACAT 
0361 TGTCTGCTGC GACAAGGAGG ACTTCTGCAA CCGTGACCTG TACCCCACCT ACACACCCAA 
0421 GCTGACCACA CCAGCGCCGG ATTTGCCCGT GAGCAGCGAG TCCCTACACA CGCTGGCCGT 
0481 CTTTGGCTCC ATCATCATNC Tc 
 in silico PCR Fragment
0001 AGTGCGAATG TTCAGCCAGA CGTCGAAGCT ATGGCCGCCG CCGCTTTGAG TGGCATGGAA 
0061 ATGGGATCTG GACCAGGATC AGAGGGATAT GAGGATGCCG ACAACGAGAA AAGCAAGACC 
0121 GTGGAAAATG CCCGCTCCCT AACCTGCTAC TGCGATGGCA GTTGTCCGGA CAATGTAAGC 
0181 AATGGAACCT GCGAGACCAG ACCCGGTGGC AGTTGC-TTC AGCGCAGTCC AACAGCTTTA 
0241 CGATGAGACG ACCGGGATGT ACGAGGAGGA GCGTACATAT GGATGCATGC CTCCCGAAGA 
0301 CAACGGTGGT TTTCTCATGT GCAAGGTAGC CGCTGTACCC CACCTGCATG GCAAGAACAT 
0361 TGTCTGCTGC GACAAGGAGG ACTTCTGCAA CCGTGACCTG TACCCCACCT ACACACCCAA 
0421 GCTGACCACA CCAGCGCCGG ATTTGCCCGT GAGCAGCGAG TCCCTACACA CGCTGGCCGT 
0481 CTTTGGCTCC ATCATCAT-C TC 
 Assemble Data

14026R-1.IR_full       1   AGTGCGAATGTTCAGCCAGACGTCGAAGCTATGGCCGCCGCCGCTTTGAGTGGCATGGAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14026R-1.in silico     1   AGTGCGAATGTTCAGCCAGACGTCGAAGCTATGGCCGCCGCCGCTTTGAGTGGCATGGAA 60


14026R-1.IR_full       61  ATGGGATCTGGACCAGGATCAGAGGGATATGAGGATGCCGACAACGAGAAAAGCAAGACC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14026R-1.in silico     61  ATGGGATCTGGACCAGGATCAGAGGGATATGAGGATGCCGACAACGAGAAAAGCAAGACC 120


14026R-1.IR_full       121 GTGGAAAATGCCCGCTCCCTAACCTGCTACTGCGATGGCAGTTGTCCGGACAATGTAAGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14026R-1.in silico     121 GTGGAAAATGCCCGCTCCCTAACCTGCTACTGCGATGGCAGTTGTCCGGACAATGTAAGC 180


14026R-1.IR_full       181 AATGGAACCTGCGAGACCAGACCCGGTGGCAGTTGCNTTCAGCGCAGTCCAACAGCTTTA 240
                           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
14026R-1.in silico     181 AATGGAACCTGCGAGACCAGACCCGGTGGCAGTTGC-TTCAGCGCAGTCCAACAGCTTTA 240


14026R-1.IR_full       241 CGATGAGACGACCGGGATGTACGAGGAGGAGCGTACATATGGATGCATGCCTCCCGAAGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14026R-1.in silico     241 CGATGAGACGACCGGGATGTACGAGGAGGAGCGTACATATGGATGCATGCCTCCCGAAGA 300


14026R-1.IR_full       301 CAACGGTGGTTTTCTCATGTGCAAGGTAGCCGCTGTACCCCACCTGCATGGCAAGAACAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14026R-1.in silico     301 CAACGGTGGTTTTCTCATGTGCAAGGTAGCCGCTGTACCCCACCTGCATGGCAAGAACAT 360


14026R-1.IR_full       361 TGTCTGCTGCGACAAGGAGGACTTCTGCAACCGTGACCTGTACCCCACCTACACACCCAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14026R-1.in silico     361 TGTCTGCTGCGACAAGGAGGACTTCTGCAACCGTGACCTGTACCCCACCTACACACCCAA 420


14026R-1.IR_full       421 GCTGACCACACCAGCGCCGGATTTGCCCGTGAGCAGCGAGTCCCTACACACGCTGGCCGT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
14026R-1.in silico     421 GCTGACCACACCAGCGCCGGATTTGCCCGTGAGCAGCGAGTCCCTACACACGCTGGCCGT 480


14026R-1.IR_full       481 CTTTGGCTCCATCATCATNCTC 502
                           |||||||||||||||||| |||
14026R-1.in silico     481 CTTTGGCTCCATCATCAT-CTC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_175975.1  CG14026-RA, transcript variant A (tkv), mRNA 
100   482  NM_175976.1  CG14026-RC, transcript variant C (tkv), mRNA 
100   482  NM_175977.1  CG14026-RB, transcript variant B (tkv), mRNA 
73.65   355  NM_175978.1  CG14026-RD, transcript variant D (tkv), mRNA 
0   NM_143059.1  CG13646-RA (CG13646), mRNA 
0   NM_167890.1  CG7852-RB, transcript variant B (CG7852), mRNA 
0   NM_206232.1  CG7852-RC, transcript variant C (CG7852), mRNA 
0   NM_139363.1  CG7852-RA, transcript variant A (CG7852), mRNA 
0   NM_137990.2  CG4797-RA, transcript variant A (CG4797), mRNA 
0   NM_166625.1  CG4797-RB, transcript variant B (CG4797), mRNA 
0   NM_176131.3  CG12052-RP, transcript variant P (lola), mRNA 
0   NM_176270.1  CG2469-RA, transcript variant A (CG2469), mRNA 
0   NM_176271.1  CG2469-RB, transcript variant B (CG2469), mRNA 
0   NM_142911.2  CG16705-RA (CG16705), mRNA 
0   NM_001043126.1  CG34158-RD, transcript variant D (SP2523), mRNA 
0   NM_131944.1  CG3546-RA (CG3546), mRNA 
0   NM_165045.1  CG31847-RA (CG31847), mRNA 
0   NM_057609.4  CG7704-RA (Taf5), mRNA 
0   NM_175956.1  CG33003-RA (CG33003), mRNA 
0   NM_135112.1  CG11030-RA (CG11030), mRNA 
0   NM_057258.2  CG10699-RA, transcript variant A (Lim3), mRNA 
0   NM_165277.1  CG10699-RB, transcript variant B (Lim3), mRNA 
0   NM_136150.1  CG10262-RA (CG10262), mRNA 
0   12  NM_206723.1  CG8260-RB, transcript variant B (CG8260), mRNA 
0   12  NM_132841.1  CG8260-RA, transcript variant A (CG8260), mRNA 
0   11  NM_132584.2  CG32654-RC (CG32654), mRNA 
0   NM_001038883.1  CG33988-RA (CG33988), mRNA 
0   NM_001014668.1  CG8318-RD, transcript variant D (Nf1), mRNA 
0   NM_170253.2  CG8318-RB, transcript variant B (Nf1), mRNA 
0   NM_170252.2  CG8318-RC, transcript variant C (Nf1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.