National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 14026R-1 
 Symbol tkv  Full Name thickveins 
 CG No CG14026  Old CG No CG14026 
 Synonyms tkv, Tkv, TKV, CG14026, Brk25D2, Brk25D1, dtfr, Atkv, l(2)04415, str, Brk25D, l(2)25Da, STK-A, Dtfr, Atr25D, tkv1 
 Accession No (Link to NCBI) NM_175975.1 
 Inserted Chr. lll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Robles-Murguia M, Rao D, Finkelstein D, Xu B, Fan Y, Demontis F.
Muscle-derived Dpp regulates feeding initiation via endocrine modulation of brain dopamine biosynthesis.
Genes Dev. (2019) [ PubMed ID = 31831628 ] [ RRC reference ]

Ma H, Zhao H, Liu F, Zhao H, Kong R, Shi L, Wei M, Li Z.
Heparan sulfate negatively regulates intestinal stem cell proliferation in Drosophila adult midgut.
Biol Open (2019) 8(10) [ PubMed ID = 31628141 ] [ RRC reference ]

Xu R, Li J, Zhao H, Kong R, Wei M, Shi L, Bai G, Li Z.
Self-restrained regulation of stem cell niche activity by niche components in the Drosophila testis.
Dev. Biol. (2018) 439(1) 42-51 [ PubMed ID = 29679558 ] [ RRC reference ]

Li Z, Zhang Y, Han L, Shi L, Lin X.
Trachea-derived dpp controls adult midgut homeostasis in Drosophila.
Dev. Cell (2013) 24(2) 133-43 [ PubMed ID = 23369712 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGTGCGAATGTTCAGCCAGACGTCGAAGCTATGGCCGCCGCCGCTTTGAGTGGCATGGAA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATGGGATCTGGACCAGGATCAGAGGGATATGAGGATGCCGACAACGAGAAAAGCAAGACC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GTGGAAAATGCCCGCTCCCTAACCTGCTACTGCGATGGCAGTTGTCCGGACAATGTAAGC 180

                           |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| silico     181 AATGGAACCTGCGAGACCAGACCCGGTGGCAGTTGC-TTCAGCGCAGTCCAACAGCTTTA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGATGAGACGACCGGGATGTACGAGGAGGAGCGTACATATGGATGCATGCCTCCCGAAGA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CAACGGTGGTTTTCTCATGTGCAAGGTAGCCGCTGTACCCCACCTGCATGGCAAGAACAT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGTCTGCTGCGACAAGGAGGACTTCTGCAACCGTGACCTGTACCCCACCTACACACCCAA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCTGACCACACCAGCGCCGGATTTGCCCGTGAGCAGCGAGTCCCTACACACGCTGGCCGT 480

14026R-1.IR_full       481 CTTTGGCTCCATCATCATNCTC 502
                           |||||||||||||||||| ||| silico     481 CTTTGGCTCCATCATCAT-CTC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_175975.1  CG14026-RA, transcript variant A (tkv), mRNA 
100   482  NM_175976.1  CG14026-RC, transcript variant C (tkv), mRNA 
100   482  NM_175977.1  CG14026-RB, transcript variant B (tkv), mRNA 
73.65   355  NM_175978.1  CG14026-RD, transcript variant D (tkv), mRNA 
0   NM_143059.1  CG13646-RA (CG13646), mRNA 
0   NM_167890.1  CG7852-RB, transcript variant B (CG7852), mRNA 
0   NM_206232.1  CG7852-RC, transcript variant C (CG7852), mRNA 
0   NM_139363.1  CG7852-RA, transcript variant A (CG7852), mRNA 
0   NM_137990.2  CG4797-RA, transcript variant A (CG4797), mRNA 
0   NM_166625.1  CG4797-RB, transcript variant B (CG4797), mRNA 
0   NM_176131.3  CG12052-RP, transcript variant P (lola), mRNA 
0   NM_176270.1  CG2469-RA, transcript variant A (CG2469), mRNA 
0   NM_176271.1  CG2469-RB, transcript variant B (CG2469), mRNA 
0   NM_142911.2  CG16705-RA (CG16705), mRNA 
0   NM_001043126.1  CG34158-RD, transcript variant D (SP2523), mRNA 
0   NM_131944.1  CG3546-RA (CG3546), mRNA 
0   NM_165045.1  CG31847-RA (CG31847), mRNA 
0   NM_057609.4  CG7704-RA (Taf5), mRNA 
0   NM_175956.1  CG33003-RA (CG33003), mRNA 
0   NM_135112.1  CG11030-RA (CG11030), mRNA 
0   NM_057258.2  CG10699-RA, transcript variant A (Lim3), mRNA 
0   NM_165277.1  CG10699-RB, transcript variant B (Lim3), mRNA 
0   NM_136150.1  CG10262-RA (CG10262), mRNA 
0   12  NM_206723.1  CG8260-RB, transcript variant B (CG8260), mRNA 
0   12  NM_132841.1  CG8260-RA, transcript variant A (CG8260), mRNA 
0   11  NM_132584.2  CG32654-RC (CG32654), mRNA 
0   NM_001038883.1  CG33988-RA (CG33988), mRNA 
0   NM_001014668.1  CG8318-RD, transcript variant D (Nf1), mRNA 
0   NM_170253.2  CG8318-RB, transcript variant B (Nf1), mRNA 
0   NM_170252.2  CG8318-RC, transcript variant C (Nf1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.