National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1395R-2 
 Symbol stg  Full Name string 
 CG No CG1395  Old CG No CG1395 
 Synonyms cdc25, str/cdc25, cdc25[string], CDC25[string], stg[cdc25], Cdc25, CG1395, Cdc25[String], String/Cdc25, SY3-4, l(3)01235, clone 2.21, Cdc25[stg], 5473, 1143/02, 1089/08, 1083/13, 0980/06, 0967/05, 0896/05, 0730/13, 0439/22, 0245/03, 0224/06, Cdc25[string], S(rux)3A, EP1213, l(3)s2213, l(3)j3D1, l(3)j1E3, l(3)j1D3, l(3)j10B9, anon-EST:Liang-2.21, stg, Stg 
 Accession No (Link to NCBI) NM_079823.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Davis TL, Rebay I.
Antagonistic regulation of the second mitotic wave by Eyes absent-Sine oculis and Combgap coordinates proliferation and specification in the Drosophila retina.
Development (2017) 144(14) 2640-2651 [ PubMed ID = 28619818 ] [ RRC reference ]

Hevia CF, López-Varea A, Esteban N, de Celis JF.
A Search for Genes Mediating the Growth-Promoting Function of TGFβ in the Drosophila melanogaster Wing Disc.
Genetics (2017) 206(1) 231-249 [ PubMed ID = 28315837 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATCTCGTCGTGCTCGCCGTT 
 Primer Seq. 3'
aatctagaggtaccCTCTGGGGTCTTTGGTGGTGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GATCTCGTCG TGCTCGCCGT TCCCTGGAAC TGATGAGCAT GGACCAGGAG GAGCTGTCGT 
0061 TCTACGACGA CGACGTTGTG CCCCAGGATC AGCAGCGATC GGCCAGTCCG GAGCTGATGG 
0121 GTCTGCTCTC GCCGGAGGGC TCGCCCCAGC GCNTTCCAGA TCGTCCGCCA GCCGAAAATT 
0181 CTGCCAGCTA TGGGAGTATC AAGTGATCAC ACGCCGNGCG CGCAGCTTCC GCATCTTCAA 
0241 CAGCCTGTCC TCCACATGCT CCATGGAGTC CTCCATGGAC GATGAGTACA TGGAGNCTCT 
0301 TCGAGATGGA GTCGCAGAGC CAACAGACCG CCCTGGGCTT CCCCAGTGGC CTAAACTCGC 
0361 TGATCAGCGG CCAGATCAAG GAGCAGCCTG CTGCCAAATC GCCAGCGGGT CTGTCCATGC 
0421 GCCGCCCTTC GGTCAGAAGG TGCCTCAGCA TGACGGAGAG CAACACCAAC AGCACCACCA 
0481 CCCCACCACC AAAGACCCCA GAG 
 in silico PCR Fragment
0001 GATCTCGTCG TGCTCGCCGT TCCCTGGAAC TGATGAGCAT GGACCAGGAG GAGCTGTCGT 
0061 TCTACGACGA CGACGTTGTG CCCCAGGATC AGCAGCGATC GGCCAGTCCG GAGCTGATGG 
0121 GTCTGCTCTC GCCGGAGGGC TCGCCCCAGC GC-TTCCAGA TCGTCCGCCA GCCGAAAATT 
0181 CTGCCAGCTA TGGGAGTATC AAGTGATCAC ACGCCG-GCG CGCAGCTTCC GCATCTTCAA 
0241 CAGCCTGTCC TCCACATGCT CCATGGAGTC CTCCATGGAC GATGAGTACA TGGAG-CTCT 
0301 TCGAGATGGA GTCGCAGAGC CAACAGACCG CCCTGGGCTT CCCCAGTGGC CTAAACTCGC 
0361 TGATCAGCGG CCAGATCAAG GAGCAGCCTG CTGCCAAATC GCCAGCGGGT CTGTCCATGC 
0421 GCCGCCCTTC GGTCAGAAGG TGCCTCAGCA TGACGGAGAG CAACACCAAC AGCACCACCA 
0481 CCCCACCACC AAAGACCCCA GAG 
 Assemble Data

1395R-2.IR_full       1   GATCTCGTCGTGCTCGCCGTTCCCTGGAACTGATGAGCATGGACCAGGAGGAGCTGTCGT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1395R-2.in silico     1   GATCTCGTCGTGCTCGCCGTTCCCTGGAACTGATGAGCATGGACCAGGAGGAGCTGTCGT 60


1395R-2.IR_full       61  TCTACGACGACGACGTTGTGCCCCAGGATCAGCAGCGATCGGCCAGTCCGGAGCTGATGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1395R-2.in silico     61  TCTACGACGACGACGTTGTGCCCCAGGATCAGCAGCGATCGGCCAGTCCGGAGCTGATGG 120


1395R-2.IR_full       121 GTCTGCTCTCGCCGGAGGGCTCGCCCCAGCGCNTTCCAGATCGTCCGCCAGCCGAAAATT 180
                          |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
1395R-2.in silico     121 GTCTGCTCTCGCCGGAGGGCTCGCCCCAGCGC-TTCCAGATCGTCCGCCAGCCGAAAATT 180


1395R-2.IR_full       181 CTGCCAGCTATGGGAGTATCAAGTGATCACACGCCGNGCGCGCAGCTTCCGCATCTTCAA 240
                          |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
1395R-2.in silico     181 CTGCCAGCTATGGGAGTATCAAGTGATCACACGCCG-GCGCGCAGCTTCCGCATCTTCAA 240


1395R-2.IR_full       241 CAGCCTGTCCTCCACATGCTCCATGGAGTCCTCCATGGACGATGAGTACATGGAGNCTCT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
1395R-2.in silico     241 CAGCCTGTCCTCCACATGCTCCATGGAGTCCTCCATGGACGATGAGTACATGGAG-CTCT 300


1395R-2.IR_full       301 TCGAGATGGAGTCGCAGAGCCAACAGACCGCCCTGGGCTTCCCCAGTGGCCTAAACTCGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1395R-2.in silico     301 TCGAGATGGAGTCGCAGAGCCAACAGACCGCCCTGGGCTTCCCCAGTGGCCTAAACTCGC 360


1395R-2.IR_full       361 TGATCAGCGGCCAGATCAAGGAGCAGCCTGCTGCCAAATCGCCAGCGGGTCTGTCCATGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1395R-2.in silico     361 TGATCAGCGGCCAGATCAAGGAGCAGCCTGCTGCCAAATCGCCAGCGGGTCTGTCCATGC 420


1395R-2.IR_full       421 GCCGCCCTTCGGTCAGAAGGTGCCTCAGCATGACGGAGAGCAACACCAACAGCACCACCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1395R-2.in silico     421 GCCGCCCTTCGGTCAGAAGGTGCCTCAGCATGACGGAGAGCAACACCAACAGCACCACCA 480


1395R-2.IR_full       481 CCCCACCACCAAAGACCCCAGAG 503
                          |||||||||||||||||||||||
1395R-2.in silico     481 CCCCACCACCAAAGACCCCAGAG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079823.2  CG1395-RA (stg), mRNA 
0.2   39  NM_137711.3  CG30389-RA, transcript variant A (CG30389), mRNA 
0.2   39  NM_137712.3  CG30389-RC, transcript variant C (CG30389), mRNA 
0.2   38  NM_166428.2  CG30389-RB, transcript variant B (CG30389), mRNA 
0.2   NM_143085.1  CG11848-RA (CG11848), mRNA 
0.2   13  NM_057624.2  CG4698-RA (Wnt4), mRNA 
0.2   17  NM_170013.2  CG31160-RA (CG31160), mRNA 
0   26  49  NM_132235.2  CG32717-RB, transcript variant B (sdt), mRNA 
0   25  42  NM_206653.1  CG32717-RE, transcript variant E (sdt), mRNA 
0   25  42  NM_132236.3  CG32717-RA, transcript variant A (sdt), mRNA 
0   11  34  NM_168113.2  CG32423-RD, transcript variant D (alan-shepard), mRNA 
0   NM_132132.1  CG4557-RA (CG4557), mRNA 
0   10  37  NM_140417.2  CG17364-RA, transcript variant A (CG17364), mRNA 
0   32  NM_176328.1  CG17364-RB, transcript variant B (CG17364), mRNA 
0   37  NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
0   12  NM_133114.2  CG32541-RA (CG32541), mRNA 
0   NM_132610.2  CG4404-RA (CG4404), mRNA 
0   13  NM_080483.2  CG6871-RA (Cat), mRNA 
0   10  111  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   10  111  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   10  111  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   NM_134978.2  CG16857-RA (CG16857), mRNA 
0   17  NM_166335.2  CG7097-RA, transcript variant A (CG7097), mRNA 
0   10  NM_167777.1  CG14619-RC, transcript variant C (CG14619), mRNA 
0   NM_132300.2  CG12664-RB (ld14), mRNA 
0   NM_169406.2  CG31363-RH, transcript variant H (Jupiter), mRNA 
0   NM_169405.2  CG31363-RA, transcript variant A (Jupiter), mRNA 
0   NM_169407.2  CG31363-RC, transcript variant C (Jupiter), mRNA 
0   NM_169404.2  CG31363-RD, transcript variant D (Jupiter), mRNA 
0   NM_169409.3  CG31363-RB, transcript variant B (Jupiter), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.