National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1388R-2 
 Symbol Tak1  Full Name TGF-beta activated kinase 1 
 CG No CG18492  Old CG No CG1388 
 Synonyms dTAK1, DTAK1, TAK, D-tak, dTak1, TAK-1, dTAK, tak1, TAK1, tak, D10, DmTak1, CG18492, CG1388, DTak1, DTak, Tak 1, Tak1 
 Accession No (Link to NCBI) NM_079356.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Sun Y, Zhang D, Guo X, Li W, Li C, Luo J, Zhou M, Xue L.
MKK3 modulates JNK-dependent cell migration and invasion.
Cell Death Dis (2019) 10(3) 149 [ PubMed ID = 30770795 ] [ RRC reference ]

Sun Y, Zhang D, Li C, Huang J, Li W, Qiu Y, Mao A, Zhou M, Xue L.
Lic regulates JNK-mediated cell death in Drosophila.
Cell Prolif. (2019) e12593 [ PubMed ID = 30847993 ] [ RRC reference ]

Bangi E, Pitsouli C, Rahme LG, Cagan R, Apidianakis Y.
Immune response to bacteria induces dissemination of Ras-activated Drosophila hindgut cells.
EMBO Rep. (2012) 13(6) 569-76 [ PubMed ID = 22498775 ] [ RRC reference ]

Leulier F, Vidal S, Saigo K, Ueda R, Lemaitre B.
Inducible expression of double-stranded RNA reveals a role for dFADD in the regulation of the antibacterial response in Drosophila adults.
Curr. Biol. (2002) 12(12) 996-1000 [ PubMed ID = 12123572 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGGCCACAGCATCGCTGGACGCACTGCAGGCAGCCTATGTGGACTTCAGTGAGATAACA 60

                          |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico     61  CTAAGAGAGAAAGTCGGCCATGGGTCCTACGGAGTGGTCTGCAAGGCCGTTTGGCGCGAC 120

                          |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| silico     121 AAGCTGGTTGCCGTCAAGGAGTTCTTCGCCAGCGCCGAGCAG-AAGGACATCGAGAAGGA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGTGAAGCAGTTGTCGCGCGTGAAGCACCCGAACATCATCGCTCTGCACGGGATATCCTC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GTACCAGCAGGCCACCTACCTGATAATGGAGTTCGCCGAAGGTGGATCGCTGCACAACTT 300

                           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico      301 CCTTCACGGCAAGGTGAAGCCGGCATATTCT-CTGGCCCACGCCATGAGCTGGGCGCGC 359

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CAATGTGCAGAGGGTCTGGCATATTTGCATGCCATGACGCCAAAACCACTAATACATCGC 419

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GACGTGAAGCCGCTGAACCTGCTCTTGACCAACAAGGGACGCAATCTGAAGATATGCGAC 479

1388R-2.IR_full       481 TTCGGCACGGTGG 492
                          ||||||||||||| silico     481 TTCGGCACGGTGG 492

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   472  NM_079356.2  CG18492-RA (Tak1), mRNA 
0   NM_167080.1  CG32742-RA (l(1)G0148), mRNA 
0   NM_132629.1  CG4330-RA (CG4330), mRNA 
0   NM_079454.2  CG6948-RA (Clc), mRNA 
0   16  NM_167705.1  CG1695-RB, transcript variant B (CG1695), mRNA 
0   10  NM_134550.1  CG1695-RA, transcript variant A (CG1695), mRNA 
0   10  NM_134551.4  CG32506-RA (CG32506), mRNA 
0   NM_057303.4  CG7831-RA (ncd), mRNA 
0   NM_169546.1  CG9374-RH, transcript variant H (lkb1), mRNA 
0   NM_169542.1  CG9374-RC, transcript variant C (lkb1), mRNA 
0   NM_169547.1  CG9374-RI, transcript variant I (lkb1), mRNA 
0   NM_169545.1  CG9374-RF, transcript variant F (lkb1), mRNA 
0   NM_142045.2  CG9374-RB, transcript variant B (lkb1), mRNA 
0   NM_169543.1  CG9374-RD, transcript variant D (lkb1), mRNA 
0   NM_169544.1  CG9374-RE, transcript variant E (lkb1), mRNA 
0   NM_169541.1  CG9374-RA, transcript variant A (lkb1), mRNA 
0   NM_001043114.1  CG33484-RD, transcript variant D (zormin), mRNA 
0   NM_001043112.1  CG33484-RB, transcript variant B (zormin), mRNA 
0   NM_206240.1  CG33484-RA, transcript variant A (zormin), mRNA 
0   NM_001043113.1  CG33484-RC, transcript variant C (zormin), mRNA 
0   NM_132320.2  CG12124-RA (CG12124), mRNA 
0   NM_136533.1  CG11641-RA (pdm3), mRNA 
0   NM_166148.1  CG8430-RB, transcript variant B (Got1), mRNA 
0   NM_137242.2  CG8430-RA, transcript variant A (Got1), mRNA 
0   NM_135937.2  CG4930-RA (CG4930), mRNA 
0   NM_141795.2  CG6693-RA (CG6693), mRNA 
0   NM_166045.1  CG6693-RA (CG6693), mRNA,water dikinase CG8553-RA, transcript variant A (SelD), mRNA 
0   NM_166046.1  CG6693-RA (CG6693), mRNA,water dikinase CG8553-RA, transcript variant A (SelD), mRNA,water dikinase CG8553-RB, transcript variant B (SelD), mRNA 
0   NM_080308.2  CG2845-RA, transcript variant A (phl), mRNA 
0   NM_001042793.1  CG2845-RB, transcript variant B (phl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.