National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1388R-2 
 Symbol Tak1  Full Name TGF-beta activated kinase 1 
 CG No CG18492  Old CG No CG1388 
 Synonyms dTAK1, DTAK1, TAK, D-tak, dTak1, TAK-1, dTAK, tak1, TAK1, tak, D10, DmTak1, CG18492, CG1388, DTak1, DTak, Tak 1, Tak1 
 Accession No (Link to NCBI) NM_079356.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Sun Y, Zhang D, Guo X, Li W, Li C, Luo J, Zhou M, Xue L.
MKK3 modulates JNK-dependent cell migration and invasion.
Cell Death Dis (2019) 10(3) 149 [ PubMed ID = 30770795 ] [ RRC reference ]

Sun Y, Zhang D, Li C, Huang J, Li W, Qiu Y, Mao A, Zhou M, Xue L.
Lic regulates JNK-mediated cell death in Drosophila.
Cell Prolif. (2019) e12593 [ PubMed ID = 30847993 ] [ RRC reference ]

Leulier F, Vidal S, Saigo K, Ueda R, Lemaitre B.
Inducible expression of double-stranded RNA reveals a role for dFADD in the regulation of the antibacterial response in Drosophila adults.
Curr. Biol. (2002) 12(12) 996-1000 [ PubMed ID = 12123572 ] [ RRC reference ]

Bangi E, Pitsouli C, Rahme LG, Cagan R, Apidianakis Y.
Immune response to bacteria induces dissemination of Ras-activated Drosophila hindgut cells.
EMBO Rep. (2012) 13(6) 569-76 [ PubMed ID = 22498775 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGCCACAGCATCGCTGGAC 
 Primer Seq. 3'
aatctagaggtaccCCACCGTGCCGAAGTCGCATA 
 Predicted Fragment Size
490 
 IR fragment full Seq
0001 ATGGCCACAG CATCNCTGGA CGCACTGCAG GCAGCCTATG TGGACTTCAG TGAGATAACA 
0061 CTAAGAGAGA AAGTCGGCCA TGGGTCCTAC GGTGTGGTCT GCAAGGCCGT TTGGCGCGAC 
0121 AAGCTGGTTG CCGTCAAGGA GTTCTTCGCC AGCGCCGAGC AGNAAGGACA TCGAGAAGGA 
0181 GGTGAAGCAG TTGTCGCGCG TGAAGCACCC GAACATCATC GCTCTGCACG GGATATCCTC 
0241 GTACCAGCAG GCCACCTACC TGATAATGGA GTTCGCCGAA GGTGGATCGC TGCACAACTT 
0301 NCCTTCACGG CAAGGTGAAG CCGGCATATT CTNCTGGCCC ACGCCATGAG CTGGGCGCGC 
0361 CAATGTGCAG AGGGTCTGGC ATATTTGCAT GCCATGACGC CAAAACCACT AATACATCGC 
0421 GACGTGAAGC CGCTGAACCT GCTCTTGACC AACAAGGGAC GCAATCTGAA GATATGCGAC 
0481 TTCGGCACGG TGG 
 in silico PCR Fragment
0001 ATGGCCACAG CATCGCTGGA CGCACTGCAG GCAGCCTATG TGGACTTCAG TGAGATAACA 
0061 CTAAGAGAGA AAGTCGGCCA TGGGTCCTAC GGAGTGGTCT GCAAGGCCGT TTGGCGCGAC 
0121 AAGCTGGTTG CCGTCAAGGA GTTCTTCGCC AGCGCCGAGC AG-AAGGACA TCGAGAAGGA 
0181 GGTGAAGCAG TTGTCGCGCG TGAAGCACCC GAACATCATC GCTCTGCACG GGATATCCTC 
0241 GTACCAGCAG GCCACCTACC TGATAATGGA GTTCGCCGAA GGTGGATCGC TGCACAACTT 
0301 -CCTTCACGG CAAGGTGAAG CCGGCATATT CT-CTGGCCC ACGCCATGAG CTGGGCGCGC 
0361 CAATGTGCAG AGGGTCTGGC ATATTTGCAT GCCATGACGC CAAAACCACT AATACATCGC 
0421 GACGTGAAGC CGCTGAACCT GCTCTTGACC AACAAGGGAC GCAATCTGAA GATATGCGAC 
0481 TTCGGCACGG TGG 
 Assemble Data

1388R-2.IR_full       1   ATGGCCACAGCATCNCTGGACGCACTGCAGGCAGCCTATGTGGACTTCAGTGAGATAACA 60
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
1388R-2.in silico     1   ATGGCCACAGCATCGCTGGACGCACTGCAGGCAGCCTATGTGGACTTCAGTGAGATAACA 60


1388R-2.IR_full       61  CTAAGAGAGAAAGTCGGCCATGGGTCCTACGGTGTGGTCTGCAAGGCCGTTTGGCGCGAC 120
                          |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
1388R-2.in silico     61  CTAAGAGAGAAAGTCGGCCATGGGTCCTACGGAGTGGTCTGCAAGGCCGTTTGGCGCGAC 120


1388R-2.IR_full       121 AAGCTGGTTGCCGTCAAGGAGTTCTTCGCCAGCGCCGAGCAGNAAGGACATCGAGAAGGA 180
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
1388R-2.in silico     121 AAGCTGGTTGCCGTCAAGGAGTTCTTCGCCAGCGCCGAGCAG-AAGGACATCGAGAAGGA 180


1388R-2.IR_full       181 GGTGAAGCAGTTGTCGCGCGTGAAGCACCCGAACATCATCGCTCTGCACGGGATATCCTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1388R-2.in silico     181 GGTGAAGCAGTTGTCGCGCGTGAAGCACCCGAACATCATCGCTCTGCACGGGATATCCTC 240


1388R-2.IR_full       241 GTACCAGCAGGCCACCTACCTGATAATGGAGTTCGCCGAAGGTGGATCGCTGCACAACTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1388R-2.in silico     241 GTACCAGCAGGCCACCTACCTGATAATGGAGTTCGCCGAAGGTGGATCGCTGCACAACTT 300


1388R-2.IR_full        301 CCTTCACGGCAAGGTGAAGCCGGCATATTCTNCTGGCCCACGCCATGAGCTGGGCGCGC 359
                           ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
1388R-2.in silico      301 CCTTCACGGCAAGGTGAAGCCGGCATATTCT-CTGGCCCACGCCATGAGCTGGGCGCGC 359


1388R-2.IR_full       361 CAATGTGCAGAGGGTCTGGCATATTTGCATGCCATGACGCCAAAACCACTAATACATCGC 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1388R-2.in silico     361 CAATGTGCAGAGGGTCTGGCATATTTGCATGCCATGACGCCAAAACCACTAATACATCGC 419


1388R-2.IR_full       421 GACGTGAAGCCGCTGAACCTGCTCTTGACCAACAAGGGACGCAATCTGAAGATATGCGAC 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1388R-2.in silico     421 GACGTGAAGCCGCTGAACCTGCTCTTGACCAACAAGGGACGCAATCTGAAGATATGCGAC 479


1388R-2.IR_full       481 TTCGGCACGGTGG 492
                          |||||||||||||
1388R-2.in silico     481 TTCGGCACGGTGG 492

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   472  NM_079356.2  CG18492-RA (Tak1), mRNA 
0   NM_167080.1  CG32742-RA (l(1)G0148), mRNA 
0   NM_132629.1  CG4330-RA (CG4330), mRNA 
0   NM_079454.2  CG6948-RA (Clc), mRNA 
0   16  NM_167705.1  CG1695-RB, transcript variant B (CG1695), mRNA 
0   10  NM_134550.1  CG1695-RA, transcript variant A (CG1695), mRNA 
0   10  NM_134551.4  CG32506-RA (CG32506), mRNA 
0   NM_057303.4  CG7831-RA (ncd), mRNA 
0   NM_169546.1  CG9374-RH, transcript variant H (lkb1), mRNA 
0   NM_169542.1  CG9374-RC, transcript variant C (lkb1), mRNA 
0   NM_169547.1  CG9374-RI, transcript variant I (lkb1), mRNA 
0   NM_169545.1  CG9374-RF, transcript variant F (lkb1), mRNA 
0   NM_142045.2  CG9374-RB, transcript variant B (lkb1), mRNA 
0   NM_169543.1  CG9374-RD, transcript variant D (lkb1), mRNA 
0   NM_169544.1  CG9374-RE, transcript variant E (lkb1), mRNA 
0   NM_169541.1  CG9374-RA, transcript variant A (lkb1), mRNA 
0   NM_001043114.1  CG33484-RD, transcript variant D (zormin), mRNA 
0   NM_001043112.1  CG33484-RB, transcript variant B (zormin), mRNA 
0   NM_206240.1  CG33484-RA, transcript variant A (zormin), mRNA 
0   NM_001043113.1  CG33484-RC, transcript variant C (zormin), mRNA 
0   NM_132320.2  CG12124-RA (CG12124), mRNA 
0   NM_136533.1  CG11641-RA (pdm3), mRNA 
0   NM_166148.1  CG8430-RB, transcript variant B (Got1), mRNA 
0   NM_137242.2  CG8430-RA, transcript variant A (Got1), mRNA 
0   NM_135937.2  CG4930-RA (CG4930), mRNA 
0   NM_141795.2  CG6693-RA (CG6693), mRNA 
0   NM_166045.1  CG6693-RA (CG6693), mRNA,water dikinase CG8553-RA, transcript variant A (SelD), mRNA 
0   NM_166046.1  CG6693-RA (CG6693), mRNA,water dikinase CG8553-RA, transcript variant A (SelD), mRNA,water dikinase CG8553-RB, transcript variant B (SelD), mRNA 
0   NM_080308.2  CG2845-RA, transcript variant A (phl), mRNA 
0   NM_001042793.1  CG2845-RB, transcript variant B (phl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.