National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1388R-1 
 Symbol Tak1  Full Name TGF-beta activated kinase 1 
 CG No CG18492  Old CG No CG1388 
 Synonyms dTAK1, DTAK1, TAK, D-tak, dTak1, TAK-1, dTAK, tak1, TAK1, tak, D10, DmTak1, CG18492, CG1388, DTak1, DTak, Tak 1, Tak1 
 Accession No (Link to NCBI) NM_079356.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Leulier F, Vidal S, Saigo K, Ueda R, Lemaitre B.
Inducible expression of double-stranded RNA reveals a role for dFADD in the regulation of the antibacterial response in Drosophila adults.
Curr. Biol. (2002) 12(12) 996-1000 [ PubMed ID = 12123572 ] [ RRC reference ]

Neisch AL, Speck O, Stronach B, Fehon RG.
Rho1 regulates apoptosis via activation of the JNK signaling pathway at the plasma membrane.
J. Cell Biol. (2010) 189(2) 311-23 [ PubMed ID = 20404112 ] [ RRC reference ]

Nelson B, Freisinger T, Ishii K, Okado K, Shinzawa N, Fukumoto S, Kanuka H.
Activation of Imd pathway in hemocyte confers infection resistance through humoral response in Drosophila.
Biochem. Biophys. Res. Commun. (2013) 430(3) 1120-5 [ PubMed ID = 23261474 ] [ RRC reference ]

Bangi E, Pitsouli C, Rahme LG, Cagan R, Apidianakis Y.
Immune response to bacteria induces dissemination of Ras-activated Drosophila hindgut cells.
EMBO Rep. (2012) 13(6) 569-76 [ PubMed ID = 22498775 ] [ RRC reference ]

Parsons LM, Grzeschik NA, Amaratunga K, Burke P, Quinn LM, Richardson HE.
A Kinome RNAi Screen in Drosophila Identifies Novel Genes Interacting with Lgl, aPKC, and Crb Cell Polarity Genes in Epithelial Tissues.
G3 (Bethesda) (2017) 7(8) 2497-2509 [ PubMed ID = 28611255 ] [ RRC reference ]

Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGGCCACAGCATCGCTGGACGCACTGCAGGCAGCCTATGTGGACTTCAGTGAGATAACA 60

                          |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico     61  CTAAGAGAGAAAGTCGGCCATGGGTCCTACGGAGTGGTCTGCAAGGCCGTTTGGCGCGAC 120

                          |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| silico     121 AAGCTGGTTGCCGTCAAGGAGTTCTTCGCCAGCGCCGAGCAG-AAGGACATCGAGAAGGA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGTGAAGCAGTTGTCGCGCGTGAAGCACCCGAACATCATCGCTCTGCACGGGATATCCTC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GTACCAGCAGGCCACCTACCTGATAATGGAGTTCGCCGAAGGTGGATCGCTGCACAACTT 300

                           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico      301 CCTTCACGGCAAGGTGAAGCCGGCATATTCT-CTGGCCCACGCCATGAGCTGGGCGCGC 359

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CAATGTGCAGAGGGTCTGGCATATTTGCATGCCATGACGCCAAAACCACTAATACATCGC 419

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GACGTGAAGCCGCTGAACCTGCTCTTGACCAACAAGGGACGCAATCTGAAGATATGCGAC 479

1388R-1.IR_full       481 TTCGGCACGGTGG 492
                          ||||||||||||| silico     481 TTCGGCACGGTGG 492

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   472  NM_079356.2  CG18492-RA (Tak1), mRNA 
0   NM_167080.1  CG32742-RA (l(1)G0148), mRNA 
0   NM_132629.1  CG4330-RA (CG4330), mRNA 
0   NM_079454.2  CG6948-RA (Clc), mRNA 
0   16  NM_167705.1  CG1695-RB, transcript variant B (CG1695), mRNA 
0   10  NM_134550.1  CG1695-RA, transcript variant A (CG1695), mRNA 
0   10  NM_134551.4  CG32506-RA (CG32506), mRNA 
0   NM_057303.4  CG7831-RA (ncd), mRNA 
0   NM_169546.1  CG9374-RH, transcript variant H (lkb1), mRNA 
0   NM_169542.1  CG9374-RC, transcript variant C (lkb1), mRNA 
0   NM_169547.1  CG9374-RI, transcript variant I (lkb1), mRNA 
0   NM_169545.1  CG9374-RF, transcript variant F (lkb1), mRNA 
0   NM_142045.2  CG9374-RB, transcript variant B (lkb1), mRNA 
0   NM_169543.1  CG9374-RD, transcript variant D (lkb1), mRNA 
0   NM_169544.1  CG9374-RE, transcript variant E (lkb1), mRNA 
0   NM_169541.1  CG9374-RA, transcript variant A (lkb1), mRNA 
0   NM_001043114.1  CG33484-RD, transcript variant D (zormin), mRNA 
0   NM_001043112.1  CG33484-RB, transcript variant B (zormin), mRNA 
0   NM_206240.1  CG33484-RA, transcript variant A (zormin), mRNA 
0   NM_001043113.1  CG33484-RC, transcript variant C (zormin), mRNA 
0   NM_132320.2  CG12124-RA (CG12124), mRNA 
0   NM_136533.1  CG11641-RA (pdm3), mRNA 
0   NM_166148.1  CG8430-RB, transcript variant B (Got1), mRNA 
0   NM_137242.2  CG8430-RA, transcript variant A (Got1), mRNA 
0   NM_135937.2  CG4930-RA (CG4930), mRNA 
0   NM_141795.2  CG6693-RA (CG6693), mRNA 
0   NM_166045.1  CG6693-RA (CG6693), mRNA,water dikinase CG8553-RA, transcript variant A (SelD), mRNA 
0   NM_166046.1  CG6693-RA (CG6693), mRNA,water dikinase CG8553-RA, transcript variant A (SelD), mRNA,water dikinase CG8553-RB, transcript variant B (SelD), mRNA 
0   NM_080308.2  CG2845-RA, transcript variant A (phl), mRNA 
0   NM_001042793.1  CG2845-RB, transcript variant B (phl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.